Description :
From Genome Similarity Track
Location :
Scaffold_1276:3495- 6064
Sequence
2569 bases(100 bases per row)
GCAACAACAAATTGTTATGCATTTGAAGAACAACATGAACATGATTACGCTGTGAAAGTGGATTAAGAATAAGAAAACATGAATGCCGACCGCGGAGCGA
CCACTGATAACGAAGTCACGCGGGACACCTCAACAGTTGGCTGAGATGCTGGAGAACGTCGTAGAACGTGCAGCGAGGGTTCAAATCGATTCCAAGTGTC
TGGCCGCGGTGGCCAAGAGTGTCAACGAAGTCGAGTCACCACTTTCCTTCTCCTCTTCATCAGGAACCTGAGCCTCGACAGCTGGAGCTGCAGCCGGACC
CTGCAAATCCTCGGTACCAGCTCCAACAGGAGCAGCAGCCAGAGCGGGACGTGGAGTACCCGGTGGCGAGTCAAACAACGAACGCCAGGTCGGAATAAGT
TCGGTTGAATCGAGAGACGGGTCAACAACCACGCTTCGGTACACATTCACGAAACGCGTACCACGAGGATTGAAGAGCTCCGGATTACGCTGGCACGGGA
AGTACGTGGTGTTGTACGGGTGCTAATGCGGTGCATTCATCCATCCAGTACGCCAAACTTGACGAGCATCGAGAGCCGGAGCTTCGGAAAGCCAGTCAGA
TGTCCGAGGTGCGAAAGGCAAGTTTTCAATAGAGTACCACGGCTTCGACGGCTCCAAAAGCAGTTCGGGACGAATGAACGACACGCCGGAAGCACTAGAT
GAAACCGAGTCACGACTCCACGCCATGTACTGCTCACGGTACTTGTTACGAAGACGATCGGCACGACGGTCGCGCTCACTGAAGAGCTTCTTTAACACAG
CTCTCAGTTCCTTCAAGCGTTCCTTGTCGTGGCCAACCTTTTTAGCTTCTTCAGCGAGACCTCGTTCAATACCAGCTAACGGAAGCCAGTGGAGACGCTC
CCACAACGCGAACCCGAGGTCACCTTGCTTACCGCCGTCACCCCGAAGGTTCGCCCAGATCATCTTGAGACGGGTCTCAATCGGAACACGCTTGGAGATG
GGGACGCTTGGATTGAAGTCAACATTGTCGAAGAGACAAGCTTGAAGAGGATAGAGCTGCCGAAGTTGCTGGTACGGGTGATCAGGATGCGAGTAATCAA
AGAACGCTTGGAGACCCTCCAACGTTGTACGCACGGTCACCTCACCAGCTGGTTCGGGAAGCGTTAAGCTCAAGAGTCGCTCGAAACACTTCTTGGCGCC
TGCGTCAGTAAACTCCATGTCCACGTACGGGAGAACCCACGGTGGCAAGGTAGACGAAGCCGGCATCGTAGGGCGAGTACCAGACAACACTCGGTGAGGC
AACGGCTCAACCGACGGTGCACCACCACGACGCGGCACCGAAGTGTAGGTTGCCGTAATTATGCGTCCAGGTCCAGCATCGAGAGTCCAAATAGGCGGAC
GAGGAGACACTGGAACAGGAAGAGAAGATGCTGGCGCCGGAGGACTTGCTAATATCGAAGGAGGCGGACCGGCAACGATGATTGGGGAAGTCATCATCGG
CGAAGGATTTGGCCGAGGTGGAGTCGGAGGACGAGCTGGGCCAAGATTACTCCAGTTCCTATTTGAATCTTCAACATCTTCGTCATCGAGTATGCTTGAA
TGTTCGGAGGGGGCCGGAACATCACCGCCACCACTGAGAGCATCAGGAGCGTCATCCACCGAAGGTTCATTGTCATCCACGTCATCTCCATGGTCGTCAT
CAGCATTCCCATCGTCATCAATCTCCATCGAAAAGTCGGGCGAAGACACGCTTGGTACGACAGCCGTCGGAACAATCGGAGCCGGCTTTGAAGACACGGA
GGCTGGTGGAGCAGCTTCAACAGGGGCAGGCCCTGCTGTAGAAACCACTCCCGAGACTTCAACTGTCTTGGACGTCGGAACAGAAGCCGAAGCAGACTTG
CCTTGTGGGACAGTTTGGTCCGACTCTTCACCTTCGTCACTCGAGCCAAACATGAGCCGCATTTCCTCGGCCTCGCGCAGAGCTTCTTCAGCAGCGCGTA
TGTCGGCTGGAGAAGGGGAAATTGTTGAAGCTGGTGGCTTGGCCACATCGTGTGGACCCTGAGGCGGGGGCGAAGGCGCGTCAGGAGAACCGGGAACATC
GTCGTGATCCCCAGGGTTCACATCCTTACCCGAAGGCTCTGTAGCAGTTTCTTGAACCGAAGGGACGCTACTTGGATCAGCAGTCCCCATGTCCACGTCA
CTCCGGTCGCCACTGAGGTCGACCACGGCGGGAGTCGAGGAAGACGCTGGTGTAGGAGGTGGCGACCATGAACTTGGAGAAGACGGTACGGACTTGGACC
GAGTCTTCATATGACGTCGGGGCGACTTGGCAGGAGAATGAGGACGAGATTTCTTGCGCTTCTTCTGGGCCGCCTTCTTCCACGCCTTCGGACCGAACAG
CGATCGACGAGCCGACTTGGGAGCTGAAGTATCGGCAGGTGGCGCATCGCCGAGACCGGCAGCTGCCATCGAAGTACTGGCCTTGTCGTTGGGATCGGAG
CCTTGTCTTCGTCAGAGTCTTCCGACTCGTCGTCTGAATCCTCACCACCTGGTCTAAGACGCTTATGGG