Description :
From Genome Similarity Track
Location :
Scaffold_182:34946- 36537
Transcript NameFunction/comments
Albla_Nc14092920notchless family protein putative

Sequence
1591 bases(100 bases per row)
CCAATATGTCCATCATCGCTCAGTTTCAGCAAGATGATGCAAGTTTGTTCTCGTTAATTATCGCCTTCGAATAGCTCCTGATGCTTTGCTTGATATAGGG
AACGAAAATTGGACCGCAGATTGACCTTCCTCTGACCTCGACCGTGCGTCAACTCGAAGAGCTAGTGAATCAATTACAGCAGAACGGAAGCACGAAGACA
CCGTATTCCTTTTATATCAATGACACCGAGATCAGCAAATCTCTTGACACTACTGTGAAAGAATTGGTAAGTTCGTATGCTTTTAGTGTCTTATTGCAAT
ATGTTGAAATGCTTGCCAGGGTATCTCGACGGAAGCAGCTTTAACGATCACATTTCAACCTCTGGCTTTGTTTCGAGTGCGTCCAGTGACGCGGTGTAGC
GACACACTCGAAGGTCATTCCGGAGCGATATTACATGTGAGCTTCAGCCCGGATGGGAAAAAACTTGCAAGTGGAGGTGGAGATGCTACTGTTCGTTTCT
GGGACACATCGACTTGTTTACCCAAATTTACTGGCCGTGGTCACAAGCACCATGTGCTTTGCACAGCTTGGTCTCCTGATGGAGAACGCTTTCTATCAGG
AGATAAAGCAGGCGAAATACGTGTGTGGGATCCTTTGGTAGGAAAGCAAGTCGGACAAGCAATCAAGGGCCATAAGCAGTGGATCACGTCACTCTGCTGG
GAGCCAATGCATTCAAACGCATCCTGCGAACGTTTTGCAAGCGCTTCCAAGGATAGCATGATCAAGGTGTGGAATGCACGTACTGGTCGCCAAATTGCAT
CGCTATCTGGGCATGTAGATTCGGTGGAGTGTGTCAAATGGGGAGGCGAAGGCTTGTTGTACAGTGCTTCGAGAGATCGAACTATCAAAGTTTGGGCGGT
GAATTCTGAGGAACAAACGGGCAAACTCATTCGTACTCTGACCGGACATGGCCACCGAATCAATTCGTTAGCACTGAATGTCGACTATGTGTGCAGAACC
GGGCCATTCGATCATGCAAATACGACATTCTCAGATCGTGAGCAGATGCACAAGGCAGCGCTGACTAGATACCAAAATGTACGAAAGAATCATCCAGAAC
GATTGGTTTCGGGGTCCGACGACTACACATTATTTTTCTGGGAGCCGGCTGTAAGCCTATAACACTTGGCCCATGACGTTTGCTGATACTTTCATGCGTG
CAGGAGAACAAGAAGTCAGTAGAGAGATTGACTGGCCATGTTCAGCCAGTGAACCATATCTGCTTTTCACCAGATGGGCGATACTTTGCAAGTGCTTCCT
TTGACAAGAAGGTGAAAATTTGGAATGGCCACACCGGAAAGTTTATCGCAACTTTGACTGGTCATGTTGGAGCTGTATATCAAGTTTGCTGGTCAAGCGA
CAGCCGATTGATTGTTAGTGCCAGCAAAGATTCCACTGTTAAAGTATGGGAACTAGCCGATCTGAAGAAAGCCAAAATCACACTACCTGGGCATGCAGAT
GAGGTATATGCACTTGACTGGTCTCCGAACGGGGACAAAGTAGCATCTGGGAGCAAAGATCGTACCATCAAGATGTACGTTTGGCCTTTTT