Description :
From Genome Similarity Track
Location :
Scaffold_700:34944- 36258
Sequence
1314 bases(100 bases per row)
ACTTGCCTTCATGTTCTTGCATTAGCGTAGTGCTCAACGCCCATTCATTCGAAAAGAGCATGACATGAACTTCCTTCGACCGGTCGAAGTGCCTTAGGAT
GGGTGAATGTGAAATACTCGTCTTCAATTTTTCGAAGGAACGACTTGCCACAGAAAAGCCATCTTCAACGGCAAAGTCTTCATCCTTGAGCTGGTACAGC
GCCGCACCGTAGACCGCGAAGTCTTGAATGAACCGACTGTAGTAATTAACCGCTCCAAGAAACGACTGCATGCCCTTTTTACTCGTTGGAAACGAAAGCT
CGGTGATGGCCGCCAGCTTCTTGGGGTCAGCTCTGATACCTTCTGGTGAAATTTTTTGCGACAGAAAGTCCACCTTGGGCTGGCAGAAGATGCTCTTGGT
GAAGCTAATGCTGATCCGACACTGTGCAAATCTTGCCAGAAATCGGTCCAGCGTCGCCAGGCAGCTGTCGAAATCCTCGCCACCGAAGCAAATATCATCC
ACAAACGATCGTCGCCCAAACACAGGTACCAGCGATGATTCGTCTGGCTCCCCGTTCGTAAACATGTCAGTGACGGGGCTGTTGACGAGTTGTAGTACAG
GGTCGGTCTCCACCGGTGCTTCGCTGTCTGCCGCGAACTTCGTTTGAAACGAACCCTCGGCGCTTGGCCCACGACGTTCCTTGGCTTGTTCTTCAGCTAA
ACGCATCTTTTCCGAGTATTCAAACCAACATCCTTTAGGTTGAACGAACCCCCAGAGTGCGCTGTCAATCATACGCTGATAGATCATGGGCGCATTCTTT
AACCCGAAGGGCATGCGTAATTTAACTCGAAATGTCCGATTGTGCAGACAAACGCCGACACTTTACGTGCTCGCAATGTCATCATGACCGCCCAGAAGCC
GCTTGCTGCATCCAGCGAGCAGAACCATAGGTAGCACTCGAGATCGGTTAACAGGACGTCGACTAGCGGAATTGCATACTCCATGATCGCGGTGATATCA
TTCACCATCTTGTAATAAATGCAGAGCCGGATGTCCAGCCCGTTCTTTTTCATCACAATCACGATCGGCGATGCTCATGGACTGTCTGAAAAGACGATCA
GTCCTGCTCGCAACAAAGCGCGCAGCAACGCGTACAGTTTGCCGAGAAATCGTAGCGGCACGCGCCGGCCACGCTGTTTACTTGGGGCGTGCCCCTGTGT
GTCGATATCGCATACCGCGCCGTAGGCTGGCGGCGGCAGTGCGTTGCCCCTAGCAATCAGGATCTGCTCGTGGTTCTTCAGCGTCGCGACCAGACGTTCT
CGGCGATCAGTCGA