Description :
From Genome Similarity Track
Location :
contig_156:34944- 35950
Transcript NameFunction/comments
g11774.t1hypothetical protein
g11775.t1hypothetical protein PHYSODRAFT_289113

Sequence
1006 bases(100 bases per row)
GCCGTCGGCAAACCTCACGTCACTGGCCACCACACGTCGAATCTCGGCGATTGCCATCGGGATCTGGTCTTTTATTCCCCCGAGAGAGTCTTCACCTTCG
GCGAACGTCAGCGCGACAAAGGCACGTCCTTCAGCCAAGACCTTGGCCTTGATATTGCAGCCGTCCTTGCTACTGGCAGTCAAGCCATGAAAGAAAAACA
CTGGAAGGCGCTTCTTTTCATTGCTCGTATTGGCCTGGTTAAGTTGTTGCAGTGGGTCAGCATTAATTTCGGACGGTCGACATAGATGCAAACAACTTAC
CGAGGTCATTGCTTTTGCTTCCTGTGGTCGATACCAGCTACTTGATGCAATTACTTGTGTGGATCTGCTTTCGCACTAGAGGTCGGGGACTCGGCGAAAA
TGGGTTCGTAATCAGCAGTGAGGTTCGTAAGCATTTTTGTAGAGCTGAAATCTGTTTTCAGGATGCGGGTCTCTATAATACGTGTGGACAAGAACGCGAG
AACAGGGTAAGTCTACACGGCCAAACAAGCATCCACCACCCCGTCAAGTCTGCCATCGGCGTCTTGTTTCTCAACCAACGAGCCTCACGTCTTTGGTATC
TCAAACGACAAAACGAAAGGTGTGTTTCTGAGCTTATGGGAGTCTAAAAGTCAAAAAGCTCCGTGTGGACATCGAAGCTGATGTTCATGTCCTTCGAGAG
TGTGAGGCCCGTGGTGACAATGCCATCCACGAGAGGCTTCGGGCCACAAACCAGAACCGCCACTCGTGAGCTCCCACTGGCCTGGGCCTTTTCGCCCATA
GCTCGCAGAATCTTGGCCGTGTCCGGTCGAGAGCCGTAGCGGAGGCAGTTGCTGAGCTGATGGTCCAGTTGAGCCTCGACGTCCCTCTCACCCCGAGTCA
GGTAAAATTCGCTGTAGAACGTGCTCGTCGGGGTATTTAACGTGGTTGGGTCCTGAACCAGAGCTGGGAAGTAGGGTCCGTCCTGGTGCGCCTCTGTTTC
AGTAAC