Description :
From Genome Similarity Track
Location :
contig_47:349432- 353152
Transcript NameFunction/comments
g9708.t1hypothetical protein

Sequence
3720 bases(100 bases per row)
TTCGTGGTATGACTGAAAGTTACGGCGCTAACGTCGTACCGGGCCGGAAACGTAACATCAACTCGACTACCTGACGGCAAGTAGGCCGAGTTGGCAAACG
CAACAGTGTAATCCGTGACAATACCGGCCCAGTAAGATATGGGTGTCACCGTCGCCGATGGAAGCGTTGCGCTCGTGTAGGTGAGCCCAGCCACTGCCTG
GTTTTCCTGGAATATGGCCCCGGTAGGGTGCCGTGTGTGAACTCCAAAAACTCCCGAGGCTTGAGCCGCCGGATTGATAATATTGCCATACGTGATCGAC
ACGCTCGTTCCGGCAGCAACGTCTTGGCCAGCAATTGTAAGGCGGATATAAGGCGAAGCCACTTGCACTATCGTCGAGGCTACAGCAATGCCTCCCAGAC
TGGACAGTGTCGCGCCCGTGAAGACAATTGTGCTGGCACTGAGAAGCGGGAACTGCAGTGCAATCACGCTCCCAACGCGTAGTGTGATGCTCGTCGTGAA
GGAGATACTGTACGCTGTCGTCGTGCCGGCTACCAGTGATGCCGCTGTCACTACCGGGCTGGAAATCGTTCCTAGAGTGATCATCGATCCCGGTACAGTA
GCTGACTCGAGGGTCGAACCGCTTGCACTTTGCGTGCGTATCAAATACGTGGAGGTTGTGCCCGAGCCTGTAGTGCCTGTAGCCAAGTTGGTTTTACATC
CTATTAGTCTTCGCAGCTCAAAAACCTCCGTGTGTCATTCGTTTTACCTGGATTCGAGATACCGTCGAGAGTGAAGGCGATCGGTCCAGCAGTAGCGTCC
GTACCGGCCACCGCGATCGTGACTTGTGCGCTGGCAGGTGTTGCTACCATTGAACTGCTCAAGTCCAATCCCGAGGTGATCGTGAGCGTCGTGGAGGCTA
CGTAGAAAGTGGAGGGGAACATGACCGTGATCGTTCCGCCGACAGGGACGGTAGTGCCTGTCGTAAAGGCCACGCCCACATTACCCGTGACGCCAGCGAC
AAGAGACGCAGGTGTGATGGTCGCAGGCGCGATGGCTGCATATCCTCGCTCTGCGCATGACAGCCACAGCAGCAATTGCAGCCACCACATCGCATCCACC
CTTTCAAGATCCGCCAACTTAGACTTACTTTAAAGATTACGCAATCTCTAGTTTAGTTTCTACATCGGTTTCTATAGATGTAGGAACTGCTCCCAAATGA
AACGAATGGCGGGACCCCGGTGCTCTCACCACAAACCGGTATTCATGAAGTTATGTATATTACTACTAGTTGGAGTGCAATGAGGTAGCCTAGTAACGTA
CTATCTATCCGCTGTGTTTGTGCTGAAGAACTGCAGTATTGATGGTTGGCTGTTGCGCGGTCGTAAGTTGTTTTTGCGTGGTCGGCCTGGTCTTCGCTTG
GGTTTCTTTTGCTGTTGGCTCCCCTCATCAGTTGAATCAGGTGTCTCCGCGATGGAATCAGCTTGAACTGAAGCATCGAGAATGGCTTCCGGTACGCTCG
GGTAGTAGTGTAGATATTGTGGTGGAATTGCGAAGTATTTGGCCGACAGCGATTTCAACTTCTTTTCCGCTAGCTCTTTGATCGGATGGCGTGGAAGCTG
AACAGACGCAATTGACGCCTGGAGTATGTCTGTGACAGCAGGACCAAACAGTTCCGCCAAGACGGCCCTCCGAATACTGTCAATGTTATCAGATCTTAGC
ATTGCGAACGAGATTGACTCCGATTCCGGCGTACCAACGGTTTTGCGAGCGGTACAAGTGCCTTGATCAATCTCGAACAGATAGTTAGCAGTATACCCTG
CAGGAGGCGGGAGGAAGTACTTGCTGAGCAAAGCGTTCCAGTCCACGAAAAACGGCCTCTTGGAGTCGTTGTGGTCAAAGAACACACCGTTCACGCCCTT
TACTTTGTTTACTTCCTTCAAAAGATCCATCGGTGTGTAGAGGTTCAGACCTTGAGTTGCCTTACGGCACCAGGCAATAACGCGGTCCGCAACGTTATGA
GAATGACCAGGAAGCAAAAAGCACAGAACAACTTTTCTGTAGGGGAACACTATCGAGAGCATTGCGAAAAACATCAGAACGGCTTTGGACTTATTTTGCC
CAACACAGTTGTCCAGCAAACTGAAGCTGACTTCGGCAGCAGGCAGACAATTACTTGCTGCTTCTTGCACCTTTTTGAGATGGTAAAGCAGCCTTAAGCT
GCAGAGGGCATCTGCATCTTTACCCTGAGCTCTCTCATCGTAGAAAAAGACATGGTTGACGCTGTTGCTGATGTCTGCCACGACAAAGTTCTGCAAAATG
AGGTTGCTGTTATAATAGTCGATCGACGGGCGAGAGTGGCCAAAGTAAGGCATCGATATACCACCACCATAGTCCTCCGCTTGAATTTGCACCCGACAGT
GCTGATTCGAGGGACGTTCGCCTGACTCGGCTGTAGCAGCATCGAAGGCGTCATCCACATTTTCCATACAGTCCACGTTGCCATCGTTGTCATCGGCTGT
ATCCGGAATGATTTCACAAGGCAGGTACTGCTCTGGTGCATGGAGGGCCGTATAGTTTCTGATGAACGACGAAACAAATCGTCTTTGGGAGATAGCTTCA
GCAAGATGCATTTGCTTTTGGAGAAGAAGACATTTCCGTTCATCAGGAGTGATATCCTCTTGTCGAAGCTGAATATCTAAACGAGTGCAGCAGTCACAAT
CGTCTTCTGTCGTTCTCGTTAGACGGACACCGGGATATAATTTGCGGACGTATTGAATGAAACGAGAGTAGCTCATTGTGCGAGCGCTGGGATCATCGCG
CTTGACATCATCTTCATATCGCGCATGGACCACAGTCCAAGTTAGTCCTGCTTCGTTGAAGAATTGACGAGGTCGTCTATGGGGGCAAGGAAAGCCGTCA
TCCAGTATCCATGTCGAGCAGTGTGTCTTAAACGCAGCCAGGTCTAAATCACTAAAGGCATGCCACGGGGGCAGCAGGAGTACGTCGGGTGTGCAGTGTA
TCAACCCCTTCCTTCAAAACTGTCCTTAATCTTGCGATTCGACTTCCTCCTACGGGAAGAATGGCACGAATAACTCGTTCAGACAACCCTTGCTGAAGAA
GCTGCAAGATAGCGCCCTCTGACTGCTCCCATTCACGTCCTCCAACTCCTGTTTCCCAGGAAGCCCACTCACGCCTGATTGCGGCGATCTTCTCCTCGCT
GAGGAGCTCAACAGCGCGGGCATATGCCGTCTCCTTGCGATCAGCTCATTTGCGTCTCTTGCGTGGGGGTATAGTCGATCGGGAGCCCCCTGTGGCTCGA
GATGACATGCTTGGCGCTGCTTCGAAGGACGCTAAGTGGTTAAGGCCTCGACAAAAATAAATAACTCCTCAAGCGAAAGGTATTTTATGCGGGACCCCGG
GGTCCCGCCATCCGTTTCAAATGTATAGCGCTGAGTTCGAGCACCTGGACTTGAGCTTTCTTTCGCAGCGACGCCATCTCGCGCCCAGGTTCATGTTCAG
CGAGCGGGTGCAGCTGTTCGTCGCCACATCATTCGCGTCCTGCGCGTGCATGACACGGTCGAGACGTCCCATGATTCAATCAGCGCCCCACACAGCAAAC
AGATTATACAGCCCACCAAGCCATGTTTGGCCGCGCTGTCCAAGAGCAACAGTCTGCGCCTCTCGCCCATGGTGCAGCTGGAGAAGGCCGCCCACAAGCT
GACGATGTACTCGCGTGCCC