Description :
From Genome Similarity Track
Location :
Scaffold_28:349421- 354026
Transcript NameFunction/comments
Phyra_97323PrAvh128
Phyra_97234PrAvh39

Sequence
4605 bases(100 bases per row)
TTTTCAGCCAGGTCTGGAGTTTCGTCGTGGTGGCAGTCGAAACCAACGCTTTGACCTTTTCAATAACGGAGCTTGGAAGGACCCCTCTCTCTTCACCGTC
GTCGTCTCCATGAAAGCGATGAAACCCAACGGTGGCGAGCTGATCGTGATCCGCGATGCGTAAACGGGCCTGAGTCAGGGAGTTCGGTTGAATAATTTCC
GATTTCTTGTGTGCGGTGGCCGTATCTGTTTTGGCGAGGAGTGCGACAGCAAACAACCCAACGCAACCTAGACGCATTCTTCACTGGAGAGAATTTTAAC
AAATAAGTAAGATAGTTTTCCACGGAGGACTGCGGACCAGTAGGCATGTGCACAGCTACATGCATGTACAGTATCACATTCATGAGTGAGCACCGTCATC
ATGATGACGGTGAAGTGCCTAAAGACAAGACTTCAAGAACTGACTTTCCCCTGGTGGTCTCAGACCATTGGCCGCAAGCAGCAGATGTCGATGGTGCGTC
TTGGGGGCGTCATTGGACGAATGTATAATTTCCATACAGATGTCCCTGTGTGGATACCGCTGATGAAATGATCGGCCATACATCAAGGTAGTCAACTTGG
TGTAGGGAAACACCGCGCAAGTCCGCTTTGGATGATGATGATGCAGCTAATATTTGGTCATGATGATACCGGTAAGTGGCCTTCTATTTGATGTGTATTG
TTCCTATCAATGTAGTAATAACATGAAAGACGCGACTTGATCTCGCTCGTCTGTTCTTGGTGGGTTTGTTTCCAGTTGATCTTGTAGCGTGAAGTTGGAA
AGGTATTCTTGCATCGGGCGTTGGGTTGTTGTAGGTGGAATTGTCGAGTCTTGTGTATCTTTGCCAGTGTTTAAACTGCTTCCAAGTCCGCGTTTGCTGG
TGTGCTCCACTGTACGACGAAGAATCGCTATAGCGCATGACTTAGTTTCTCGGTGGGGCTGTCGCTCACGGTTGTCTCTGGTTTGCACTGAGGTCTCCTG
AATTGCTTTATCCACACTGATATTTCGACGCTAACCTCAAGAGTTTTGTAGTGTCACTGCAATGGACATGGGAACCGCTCTTTGTTTGACACTTCGCACG
TTGTGCACTGTTGGAGCGATTCCCGCAGCCATTTGAACTGGTTCAGATCCAAGATTTGCCCTACTCCATACATAGAAAATTCATTTTATTCTTCAGGGGC
TCTTTCAGATCATGGATCTGGGTTTTGGAGGAATAAACCTGCGAACATGGATAAAATGACCTTAATTAAGCGCTCTACCTGTCAATCTTAATAACTTCAA
CTACCAAGCCACACTCTTTTTCCGCATCAAGGTCTGTCCCGCATCAAGCTCAAGACTCCAGACTGCCCACCACGGACGCGGAGGTGGACACAGAGGTCGG
ACGACAGCAGCGGAGTGAGCAGGAGCTGGGACTTTTCAACTTGGAGGCGAACCTATTCAAGCCTTTGAGCTGTTATTACCGACCGCAAGCGTCATGGCAA
GGCGCGGGTGTCGAGAATTACAGCCCCCACGATGTGGACGTCCTCCTGGAGTTCATTACATGTAGTGACGTTCTGCCGCTCAAGAAGAAATTGCAAGCGT
TGCTAAACGTCAAGAAACCAACTGGGGATCCAAGGCGCCCTGAAAATGTCCGGGTGGCCCGTCAGATCCAGCGCCGGACCAAAGAAAAGGTGTCTATGGA
GAACGACGTTGGTGACAAAAGAGCTTTGAGCAATGAAGAGGACAGCATCGACAGCATCCCACACTCCTCCAGCGTTAGGTGAAAATGAAGGTGACAACTC
ATGCCATTGCCTGTTTGCACCCTACCTGAGTTCAAAGTGCGAAAGCAAGTAGTGGAAGCAGCTAACATCAAATCTGGTCGTAGTGATAAACCTTCTGTCA
TTTCCAGCGCCGTAAATCGCCTCCCATGCCGTTCCATATCGTGGAGGTCGGCTCTCGTGAGGTAGTGTTGGCCGCGCTGACGATCACGCCTCTCTCTCTC
TGGCCTTCGGCGGTGATTGTAAGCATCAGAATGAGCACAATGCTCTTGCCGTTGCCCTCGTAGCTCATATTATAGTAGATGTGGAACAGAGTGCTGCGGG
TGGGCACGTACTTTTCTAAATCTGTGCGCACCAGCTAAACCTATGTTTTGGCATCCCAGAATAGCTGCGGGAATCGCTCCAATATCACTTACTTATGCAA
TGTACGGAGAAGTGAGTATCACGCTTGACCAGTATACACGCAACTTGAACCGGATTAGATCACCCCGATGAAGTACTTGTAAGCGTAGACAATCTCAGCG
TCCTTCTTGGACCACATGCCGTTGCCTGACGCCTTCAGGTCTGCTTTAACGGCTGTTGGGCGTTTTCCAGCAACCATCCATCTCGTGAACTGTGCCTCCT
GCAACTCTGTAGCAAGTTTTTTCATCCGAGGCGCGGTCGAAGCCTTTGCTCCATCAATCATTCGTGCCAAGACTTCGTCGTTGTTGTCGAAGTGTTTCAG
TAAAGTATTGGCCATGGCCGCTCCGGCGCCGTCCTTCTTGAGCTTGGTCACGTAGTCGGCCCAGGCTAGGAACTCTTTGCTGCCAAACAGAAATTTCTTG
TTTTTGCTTTGAAGATTCAGGAGCTTGAAGGACGCCTCGGCGGATTTCTTGCGCGTGAGCCACCACTGCTGCTGCGTCTTTTTGGCAGTCGTCTTGGCCA
AGTTCTCGAGACCGGAGGTTGCAATTCCTCTCTCCTCTTCGTTGCCATCGTCCTCTTCCGTAGCCCCCAAGCGTCGGTCTGGAACGATGTCGTCCTCGTT
CGTAGCCCTCAAGTGTCGGTCTGGAACGATGTCGTTTTCGTCAGCAGTCACAACCGAGGAGACGAGCAAATTCGCGGTCGCAGACGTCCCCTGGATCGTT
GTAAGGACAGCCACAGCGAATAACACGATGTAGTGAATGTGCATCGTTGAGAAGCAAGTTTTGGGGTCGAGCAGTGAGTCTTACGCTGACCAGTGAAGAG
TGAGGGGGACCCGGCGCTCTGTCGTCTGTCGTCCCTAAACAGATCTCAAAGTGCATCTCGGTCCGATCATGAAGCTTATCCAGTGGTGACATCCACAAGA
AGTGCCCAATTAATTGCAAGCAAAGTTGGCACTGCAAAATGGTGGCGATCATGCCGCCACCAACTCATGTTAGCTAGAGTCGCTATACATGTACATGTAC
ACTAACAAACAGTTTGTAAACAGTGTTAGAAGCATACATGTATATTCAGCGTGAGGACGCCACGCTTAGCCATCTATTATATCAGCGAGTGGTGGCAATT
GATGAATGAAACAGGCGTCTCCAGACGGAGTCGGCGGACAAGCTATAGTCTGCGGCCGACGCTCTTCATCCCGGTCACTGTGCGACCACGCAAGCAAAAA
GCAGAACCTTCGGCGGCTCGCGTGATACAAACACCAAAAAGGGATACTCGCTCCTGTTCGTGGGTGGTTTCGAGAATCTCTACCTTATTGCACGTGCGTA
CAAGTACCCCCGCCCAATATTAAGAACTAGCCTTCCGAACATCCTCTTTCTGCAATATCGAAATGGGCGCTTGTGCCGTATCCATATATTCTAGGCTTTC
TCGATGACCAGCAATTTGAGTTCTGTGAAGAGCGCCGTCCGTTTCTTCCTGATTGGTATTCCCGACCGTTAACAGCGTTGAATTGTCCTGCAAAAGCAGT
CAGGGGCTGATTTAAGATGTCACGATGCCTTCTCCTGGTTGTACACGATGCGGTCTACTTTCGCAATATCATCATGGGGTGTATGTCCTGGAGTCGAGCT
GAAGGTTTGCCACAATAAGCTGCATGTTTGCTACAAATGCTTCGTGGTCAAAAGGTTGGGAATTTAAACGAAAGCCAACTTCGTGTATCTAGCGGCTCTT
GTCGAGTCACCACTTTTGTCTTTAGGACGATTACCTTGTAAGCTTAGAATATTGGCTTACCTTGCCGTATCCGATACTGGATGCCATTCCACCGCAACCT
GCACCTGTACATACAGGAAATGACCTCGTGATCACCACAACACTTGGGATTCCTTGCAGCCTCTAACCAACAACCAAGCAAATACATGCATGACGGCCGC
CTTCAAGATAATCGAGGAAGTGGTGCGGCCTCCATCGCAGACTTTGACGGGCGGGTGGCCAGACTCAAGGCGGTTGTAGAGGAGCCGGAGATCTTGCTCG
CGGCGCTAGCTTTTGCGTGGCGCATCAGTAATGCAAAATGTCTTGACAGGAACCTCGTTCAACTGGGGCAGAACTTAAAGACTTTGCCGGCAGTGCGGGA
AATCACGACGGACGTGGTGAAAGCCATGGTCGATACGCCAAGTCAGATGGATCGGAGGAGCGGCACGATCTTCCTTTAATTGGGTTACCACAGCTGCGAC
GGACTGTTGCCGCCAATGCTTGGTTACATTGTTCGGAAGCGACACGTCGATGGTCATATCTCGCAGCCGAACTATTAAAACGAGGAGAGTAGCCTCACTG
GCCAGCGGTCAATACTTCAGCTACTAGTTACGTAGATGAGGTGAGCTTTCAAAGGCCTTTGCTCAGTACGGGCCCCTGGAGAGCGAATTTGCTACATTTT
TCCCG