Description :
From Genome Similarity Track
Location :
Scaffold_4:349419- 350427
Sequence
1008 bases(100 bases per row)
TAAACGCTTCTTGCCAAAGGTGTGCAGTGAAGCGCGGGTGTCGATCCGACACAATGTCGATCGGCATGCCATGGTGTTTGAACACCATGTCAACGAACAG
ACGCGCCGTCTGTTTCGCAGTCACTTCAGCGGGTACTGCAGCAAGATGTACCATCGTGCTGAAGCGGTCAACAAAGACCACAACGCCCGTGTTCCCCTGG
CTGTCCGGGGGAAGACCGAACACGAAGTCCAAAGACATGGACTGCCAACACTCCCGTGGAGTTGGTAGTGACTGCAAGGGAGCCTGCGCGAAAGGCGCAG
GCTTCGCACGTTGACAAACCTCGCAAGCACAGACGTACTTGCGCACCCATTTATACTGGTGGGCACAGTAGAAGTCTCGCGTGAGAAGAAGGTATGTCTT
CTCACGGCCCGGATGCCCCGCAGTCGGTGCATCGTGATACTCATACATGATCCTGAGTCGCAGGTCATGGACATTGGGCACGACAACGCGGTCCGCGTTG
TCGTCGACTGCACTGTAGAGTAATAACCCGTCGTGCACCTAACGGCGTGCACGAGCACGAAGATGCTTCGGCAGCTTCTGACGAGCTTGGTCAGAAGGCG
CTGAGCCGTAGGCCAGCAAGAGCTTCGCGTCCACGTCGTCCGCGCACGCGACCTTCACGTCGTCCAACAGTGACGACGTCGGGGTGCTCGATCGCATGGC
GTCAATGGCATTGACGTCGGCATCAGCCGTGGCGTAGTCAGGTCGACGCGAGAGCGCGTCGGCCACCACATTGAGTCTTCCGGGTTTGTACTCAACCCGG
AAGTTATACTCTGCCAAGAATGAGAGCCATCTCGCCATCCGTTGCGAGATGTGCGGCGACTTCACAGCCGTCCGCAACGACGCGTGGTCCGTATAGACCA
CGAACGGTTTGCTTCCGAGTAGATACACTCGGAACTTCGCGGGTGCGTACTTCATGGCAAGGAGCTCCTTGTCATGTACCGGGTAGTTGCACTCAGCTGG
CTTCAGCT