Description :
From Genome Similarity Track
Location :
Scaffold_11:3494142- 3495888
Sequence
1746 bases(100 bases per row)
GGAACCTTTTGCCATATTTATTATCAATAATTGGTCCAATACCATATTGTATTGATAAGCTCAACTACCAATAATACATATTTACATTGCAAAACCAAAT
AATTTATTGAATCGCAATTATTATTTCTGACCTCTGCATAAATATAGATAGTTTTAGATTAAATAAAATGAACTCTAATTCATTGTTTTCTAAGAGTTGT
TTAGACAGCAAAATCCAATACTACTTAACGGGCGGACGTGTCGTCGACAGGGGCGTAGGATACGGTTTTAAATGGAGCGGCAATACAGCAACAAAACACG
AGAGGTGTGATATATAGCTGGTTAAGTAGACCCCATAATGAAACGCTAATAAACTTGGAGCCTAAATGACGATTAACCATCTACTAAGGTCCATTAATTA
TTAAATAAAAAACACTTCCGTCCACAACAACAACACTAATTCAAATTGCTAAATTATAACTGGCACAGAATCGAGTTTTTTATACTAATTCTGAATCAGC
ACAAAATGAACGCTACATGCACAAAAATATTACAATTTGAATATTTTCATCAATCTTTACTTACTTAAATATTACAATTTGAATATTTTCATCAATCTTT
ACTTACTTACAAGCTCAAATAGGCAGTACAAGCGGGTAAGTAGTACAAGCTGGGCAGGCTATTACTATCTTTTGTGTTGATGTGAGTTAAGTTTGATAGC
GGTTTGAAACGACCCGTTATACCGAGCACGACGCTGAACTAGCAGTAAACATATTGTGTAGCGTTTGTATAAATGCCATTTGAGGTGCAGGTGGAATATG
AAGATACAGTGATAACAACAAAAATAAAGAGATTGCATGAAGACCATTAGAATAATAATTTTAGATGTAGTAGGCACAATGCTGGGCTCAGTCTTTTGTA
AAAATAATTGCACGGATTTCTGATGACTCAGCATTTTGTAGAGACTGCTTATAATCGCTTCGTGCCTGATAATATACTGGAAGTATATTATACCCAGATT
ATTGAAATTAAAAAGTCAATTTAGAATATACTGAATAAAATAGGCTCCGTTTTTTAGGATAATTGTCCCGTCGAAGCACAGCGGGGGCTAAGCAAGTCGA
ACTACTGGTAAACCTAAATTACCGCCGCGTAGCGACGGCGCTCGGCTAGCTGTATAGTGGTGGTATTAAAAGAGTTAACTGTCTGCCTCTCTCGCCTAGC
ATCATCCAAGGTTCCTCCGCAACACTTGCAAATTTAGCCATCCAATCTAAGAACCTTCTCCAGCTTTTCACCGCCAGAAGATTGAGATTTGCTTGTATAG
GAGGAATTGTACCGTAATTGTTGATAAGCGACTCCAGCTCCGAGTCCAGCAAATCCTTCCAGGAAACGTGAAGAATGGACTTTGTGAGGATCTTCGCGTC
ATTTTGCATGTGAGAGGGGGACGCGTCCAACAATTCATAAAGATCAATCCACAAACGCTGTTCATCCTTGACAATCATATTCGGCACGCGAGGATCTCCG
TGGGCCACGCCAGCAGAGTGGAGCTGCCATAGCATGTCAAAAAGGACTCGCGCCTCCTGACTTGTGGTAGGATACGATATAGGCTTCCCGACAGGAGACA
GCAACATCGCCGCGCCATCAGAAAGCTCTGTAGCCTCCCCCACGGGTCGAATCACCAGACCAGTGTCCTGGGCACGAACTAACGCTTCGTATTCTAGAAA
AAGACGTCTAATCGAGAACTCCTCCACGATCTTCAAGGCCAGCACA