Description :
From Genome Similarity Track
Location :
contig_156:34941- 40027
Transcript NameFunction/comments
g13885.t1hypothetical protein
g13886.t1ETM00529.1 hypothetical protein L917_02754 [Phytophthora parasitica

Sequence
5086 bases(100 bases per row)
TCTTGACCTTGTGGTCGTCCATCTCCTCAACCACAGCACGAGCGATCAAGCCGCCCATCGAATGTCCCATGAAGACGTAGCCGTCGGCAAACCTCACGTC
ACTGGCCACCACACGTCGAATCTCGGCGATTGCCATCGGGATCTGGTCTTTTATTCCCCCGAGAGAGTCTTCACCTTCGGCGAACGTCAGCGCGACAAAG
GCACGTCCTTCAGCCAAGACCTTGGCCTTGATATTGCAGCCGTCCTTGCTACTGGCAGTCAAGCCATGAAAGAAAAACACTGGAAGGCGCTTCTTTTCAT
TGCTCGTATTGGCCTGGTTAAGTTGTTGCAGTGGGTCAGCATTAATTTCGGACGGTCGACATAGATGCAAACAACTTACCGAGGTCATTGCTTTTGCTTC
CTGTGGTCGATACCAGCTACTTGATGCAATTACTTGTGTGGATCTGCTTTCGCACTAGAGGTCGGGGACTCGGCGAAAATGGGTTCGTAATCAGCAGTGA
GGTTCGTAAGCATTTTTGTAGAGCTGAAATCTGTTTTCAGGATGCGGGTCTCTATAATACGTGTGGACAAGAACGCGAGAACAGGGTAAGTCTACACGGC
CAAACAAGCATCCACCACCCCGTCAAGTCTGCCATCGGCGTCTTGTTTCTCAACCAACGAGCCTCACGTCTTTGGTATCTCAAACGACAAAACGAAAGGT
GTGTTTCTGAGCTTATGGGAGTCTAAAAGTCAAAAAGCTCCGTGTGGACATCGAAGCTGATGTTCATGTCCTTCGAGAGTGTGAGGCCCGTGGTGACAAT
GCCATCCACGAGAGGCTTCGGGCCACAAACCAGAACCGCCACTCGTGAGCTCCCACTGGCCTGGGCCTTTTCGCCCATAGCTCGCAGAATCTTGGCCGTG
TCCGGTCGAGAGCCGTAGCGGAGGCAGTTGCTGAGCTGATGGTCCAGTTGAGCCTCGACGTCCCTCTCACCCCGAGTCAGGTAAAATTCGCTGTAGAACG
TGCTCGTCGGGGTATTTAACGTGGTTGGGTCCTGAACCAGAGCTGGGAAGTAGGGTCCGTCCTGGTGCGCCTCTGTTTCAGTAACCAGAGCCTGAATGAG
GTTGCGATCACGTACAGACCATACAAAGTGGACATTCTTGATGTCAGGGCGGAACCCGTTGTGGCTTTCACTGTGCAACCAGTTGACAATGGAGCGCATG
GGAGTAATGCCAATGCCTCCAGAGAACAGGACGAAGTGCGAGTAAACCGACGGACTGTGGATGTCAACCGAGACGCTGCCGTACGGTCCATCCAGCAGGA
TGTCAAAAGGAGACTCTTCTGCTGCGTCCTGAGCTGCACTTGTGACCTTCTTGGTCCAATCTCCGAGCCCCTTGATGTGAAAAGTGACCATTTCTTCACT
TGGCGACGACGAGATCGTGAACGGATGCCACTCGAGCGACGAAATTGTTGGGATGCATAGAAACGCGTATTGTCCTGCCTCGTACTCGAAAGCCTGGCCG
TTGTCTTTGCGAACTCGTGGGAACTGGATGCGCGTGATGTCTCCTGGTAAGGCGTGGACGGACACTTGGTCGCGGGCGACGATGCCCGTCTGAGCTCCTC
TCTTCGACGGGCCTCGAATGTAGTTGCGTGCACGGAAAACGAGTCGGTAGAGCATGTCGACCAGCCACGGTAAGATGCCGAAGAGAGCGAAGAAGGCGCC
GTGAGCCACCGCAGCCACGATCACTACGATGAAGAGGATCCAGTGCACGCGCACGAAGAGCTCGAAGAAACGACGGCGGATCTTGTTGAGCGAGAACAAG
TACATGAAGATCATGGCCACGTACGCGATTGCTCCGGTTCGGACCTTGAACTCCATGTCCTCTTCCTCGCCGTCGTCGTCTGCCAGTCGGTGCGAGAAGG
CGTGCAGCGCTGTCAGGACGATCGTAGCGTAGGCGAACAACTTGTGGTAGAACAACGCCCGCTCAAAGGGGATGCCCGTCAGCGTGAGTAGCAGCGAATT
GTTACGCACCGCCAGCCCAAACACGAGCATCATGGTGAACGTCGGTGGCATGCCGGACATTTTCACGTCGTGTTCGCTGGTGAACACCCCTGATGCAGCC
AGAAGGATCAGGAGCAGCGGAAGCGTCAGCACCAGGTCTCCTCGCTTGATGTCGAACTTCGCCGTGAGCAGTGGCACGGGAACCGCGTAGATGGTGCGCG
ACAGTCGCCAGCGCGTCACGACCCACGCGCGGACCCATTTCTGCGTCCGAGAGAGCTCTTCTGGGACGCTTTGGTGTTTCGGTGAGACTGCGTGGACGTA
GGGATTCGACGGCGTGAAGACGTCTCCAACGCGGTTCTCGATAGGGCCGTAGCTTAGTTCTGGACCACCATGCCGGTGGTGCTGGGTGCGCGTTGGTCAT
CGCTGAGTCTTCGCCGTGGAGGTGTCTTCGAGAAACTTGGTGCTTTGAAAAGTGAGAGGCGGGAAGTACCACCGGACTGCAAGGGATAGACTTGAGTGGT
GGCGCTACATATGTGCGAGAGTTGGTGGTAGTCTCGCCAGCCCCGATACAGAATGCAGGCGCTGGATAATAATCAAACGAGCTCTGGGTTTGATTACCAC
AAATGTTTCCTGTGGATCGGCGAGTCCGGATACTGTCAAAGGCGTCAGCGGCCCTGCCCCTAGTGCGATGACCACACCGCGACATATCGACGAGCTGTTG
TGATTGATAACCTGCTATTCATTCGAAGTGCCTGTTAGCAACTTGTGACGAAAGAATGATGCATGTCTGTTAGAGCCAACACCAAGTGAGGTAATCATCT
CCATCCAGGCTATGATAGCCACCGCATTAGATATACCCCGTTACCAATTCAACCAGTTGAGGCGACTGGAGCTAGAAGCTCGAGCGTCCGAGTGGTTTAA
CTCACCTCAGTTTCCAATTTCCGGTCCACCGCACACTTCAAGTCCCCAAGTCCGCTCCCAGTCATGGCGTCACCACGAAACCACTTCATTCGGGTGAACG
ACACCCCGAAGACCCGCAACGTTGCTTCGGAGCCGCTCAAGTTCACCCTGCAATGGAGAAATCTGAGCCTCAAAGCCGAAGTGAAGAACCCAGCCACGAA
GAAGACAGAGGAGAAAGTGATCCTGAACGATGTCAGTGGATCGGCCCAGCCGGGCGAGTTGCTGGTGATCATGGGACCTTCGGGGGCTGGCAAGAGCTCT
CTTCTTGACTGCATTTCCGGACGCAACGGCGCTGTTGAAGGCGACATCTTACTCAACGGGCAGCCGTGGACCAAGGCGACAAAGCGCATGGCTTCGTACG
TCATGCAGGACGACCTCTTCTACGAGACGTTGACTGTCAAGGAGCATCTTATCTTCCAGGCGCGACTTCGCATGGGCAAGACGTCTACCGAGCAACAATA
CATGCATCGAGTGGACGAGGTCATGGAGGAGCTGGGACTCATGAAGTGCCGTGATACTCTTATCGGTGGCGAGTCGCTGCGTGGGATCTCCGGCGGTGAG
CGCAAACGTTTGTCGTTCGCCACAGAAATCCTCACCAACCCGTCGATCCTGTTCGCTGACGAGCCAACTTCCGGTCTGGACAGCTTCATGGCGGAGACGG
TGATCAAGCAGTTGCAGCAGATCGCTCGTGACGGGCGAACGGTTCTCGCCACGATCCATCAGCCGTCGTCTGAGGTGTTCGCCATCTTTGACCAGCTTTA
TCTACTGTCGGACGGGTCCCCAGTCTACCAGGGCAAGGCCAGCGAGTCGGTGGACTACTTTGCGTCGCTCGGGTACCCGTGCCCGCCGCAGATCAACCCC
TCCGACTACTTCATGCGCCAACTTGTTGTCATTGACAAGGCGACTGACGAAGCTGGTGTAGCTCGAGTGGAATCTCTCAAAGGAGAGTGGAGGAAGCACC
AGACACTGTCGCGATCTGAATCGGTGTCACTGCAGGAAGGAGGCGGCTCTCAACTTGAGAGTACGCGCCTGCATCTGCTGGGTCAGATCAGCGTGCTTGC
TCAGCGTAACACCCTGCGGTTCCTTCGGGACGGCTTTGCAGTCCGCGTTCCTTTCATCCAGAACCTTTTCCTCGCCGTGATCGTTGGTTTGATCTACCTG
CAGTTGGACTTGGACCAGAAGGGCATCCAAAACTACACTGGTGCCTTCTTCTTCCTCGTCACCAACCAGATCGTCGTGACTGCAAACCCAGTGTTTGTGT
CGGTTCCCATGGAGTTGGCGCTCATTTCCCGAGAGTACAAAGGGGGTCTCTACCACTTGATGTCGTGGTACCTGTCCAAGAACATCAGCGAGCTCCCCAT
GCAGATCATCCTGCCGATCGTGTTCTTCGTCCCGATCTACTTCCTCATGGGAATCGGCCACGGCTTCGAGGTATTCATCTACCTGCAGCTCGTCATGATC
TTAATCAACAGCACGGCGATTGGTCTGGCCTACATGGTCTCGTGTCTGTGCCCGCGTGTCGACATTGCGCCGCTCATCGGTATGGTTCTGATCATGCCGT
TCATGCTGTTCGGAGGGCTGCTGATCAATTCGGACGACTGCCCCGACTACTTCGTGTGGATTCAGTACATTTCGCCCGTCAAGTACGGGTACGAGGCCAT
GATGAAGATCTTCTGGAACGCAGTTCCGTCCATCGCGTGCAGCACGGCGAATTGCACTGCTCGTACGGGTGCAGAGGTACTCGAAAGTTACAGTATGACT
TCCCGATCTGCGCTTGGGGACTCTCTTCTGCTGCTTCTCCTTAATATCGTCTTCCGTGTCATTGCATTCGTCGCGATCTGGTTCCAGCTGCGCCAGAAGA
AGTAAGCGTAGCCTAGTACCTACTAGGCTCTACAAAGCTCAATCAATCGGCATATCTTTCGTTTTAGTGCTGGCAGTTGTGATCGCCGTTGGCACATTGC
AGATATATACCAAGCAGCATCTTAATTTTAGTTATGAGAGTACGACTGTGTCATTCACTCGTCCAACTTTGAGAGAACGTAAATGGATCAAGGACTGGCT
CGCGTTCTCGATTCGTTTTGCAGCATCACGTCGACGCTGTAAGAACAATGACGTGTTTCCAAGGCATTGGAAAGCGTGGTTGCTTG