Description :
From Genome Similarity Track
Location :
contig_156:34940- 40027
Transcript NameFunction/comments
g14409.t1hypothetical protein
g14410.t1ETI54172.1 hypothetical protein F443_02981 [Phytophthora parasitica P1569
g14411.t1hypothetical protein

Sequence
5087 bases(100 bases per row)
TGTGGTCGTCCATCTCCTCAACCACAGCACGAGCGATCAAGCCGCCCATCGAATGTCCCATGAAGACGTAGCCGTCGGCAAACCTCACGTCACTGGCCAC
CACACGTCGAATCTCGGCGATTGCCATCGGGATCTGGTCTTTTATTCCCCCGAGAGAGTCTTCACCTTCGGCGAACGTCAGCGCGACAAAGGCACGTCCT
TCAGCCAAGACCTTGGCCTTGATATTGCAGCCGTCCTTGCTACTGGCAGTCAAGCCATGAAAGAAAAACACTGGAAGGCGCTTCTTTTCATTGCTCGTAT
TGGCCTGGTTAAGTTGTTGCAGTGGGTCAGCATTAATTTCGGACGGTCGACATAGATGCAAACAACTTACCGAGGTCATTGCTTTTGCTTCCTGTGGTCG
ATACCAGCTACTTGATGCAATTACTTGTGTGGATCTGCTTTCGCACTAGAGGTCGGGGACTCGGCGAAAATGGGTTCGTAATCAGCAGTGAGGTTCGTAA
GCATTTTTGTAGAGCTGAAATCTGTTTTCAGGATGCGGGTCTCTATAATACGTGTGGACAAGAACGCGAGAACAGGGTAAGTCTACACGGCCAAACAAGC
ATCCACCACCCCGTCAAGTCTGCCATCGGCGTCTTGTTTCTCAACCAACGAGCCTCACGTCTTTGGTATCTCAAACGACAAAACGAAAGGTGTGTTTCTG
AGCTTATGGGAGTCTAAAAGTCAAAAAGCTCCGTGTGGACATCGAAGCTGATGTTCATGTCCTTCGAGAGTGTGAGGCCCGTGGTGACAATGCCATCCAC
GAGAGGCTTCGGGCCACAAACCAGAACCGCCACTCGTGAGCTCCCACTGGCCTGGGCCTTTTCGCCCATAGCTCGCAGAATCTTGGCCGTGTCCGGTCGA
GAGCCGTAGCGGAGGCAGTTGCTGAGCTGATGGTCCAGTTGAGCCTCGACGTCCCTCTCACCCCGAGTCAGGTAAAATTCGCTGTAGAACGTGCTCGTCG
GGGTATTTAACGTGGTTGGGTCCTGAACCAGAGCTGGGAAGTAGGGTCCGTCCTGGTGCGCCTCTGTTTCAGTAACCAGAGCCTGAATGAGGTTGCGATC
ACGTACAGACCATACAAAGTGGACATTCTTGATGTCAGGGCGGAACCCGTTGTGGCTTTCACTGTGCAACCAGTTGACAATGGAGCGCATGGGAGTAATG
CCAATGCCTCCAGAGAACAGGACGAAGTGCGAGTAAACCGACGGACTGTGGATGTCAACCGAGACGCTGCCGTACGGTCCATCCAGCAGGATGTCAAAAG
GAGACTCTTCTGCTGCGTCCTGAGCTGCACTTGTGACCTTCTTGGTCCAATCTCCGAGCCCCTTGATGTGAAAAGTGACCATTTCTTCACTTGGCGACGA
CGAGATCGTGAACGGATGCCACTCGAGCGACGAAATTGTTGGGATGCATAGAAACGCGTATTGTCCTGCCTCGTACTCGAAAGCCTGGCCGTTGTCTTTG
CGAACTCGTGGGAACTGGATGCGCGTGATGTCTCCTGGTAAGGCGTGGACGGACACTTGGTCGCGGGCGACGATGCCCGTCTGAGCTCCTCTCTTCGACG
GGCCTCGAATGTAGTTGCGTGCACGGAAAACGAGTCGGTAGAGCATGTCGACCAGCCACGGTAAGATGCCGAAGAGAGCGAAGAAGGCGCCGTGAGCCAC
CGCAGCCACGATCACTACGATGAAGAGGATCCAGTGCACGCGCACGAAGAGCTCGAAGAAACGACGGCGGATCTTGTTGAGCGAGAACAAGTACATGAAG
ATCATGGCCACGTACGCGATTGCTCCGGTTCGGACCTTGAACTCCATGTCCTCTTCCTCGCCGTCGTCGTCTGCCAGTCGGTGCGAGAAGGCGTGCAGCG
CTGTCAGGACGATCGTAGCGTAGGCGAACAACTTGTGGTAGAACAACGCCCGCTCAAAGGGGATGCCCGTCAGCGTGAGTAGCAGCGAATTGTTACGCAC
CGCCAGCCCAAACACGAGCATCATGGTGAACGTCGGTGGCATGCCGGACATTTTCACGTCGTGTTCGCTGGTGAACACCCCTGATGCAGCCAGAAGGATC
AGGAGCAGCGGAAGCGTCAGCACCAGGTCTCCTCGCTTGATGTCGAACTTCGCCGTGAGCAGTGGCACGGGAACCGCGTAGATGGTGCGCGACAGTCGCC
AGCGCGTCACGACCCACGCGCGGACCCATTTCTGCGTCCGAGAGAGCTCTTCTGGGACGCTTTGGTGTTTCGGTGAGACTGCGTGGACGTAGGGATTCGA
CGGCGTGAAGACGTCTCCAACGCGGTTCTCGATAGGGCCGTAGCTTAGTTCTGGACCACCATGCCGGTGGTGCTGGGTGCGCGTTGGTCATCGCTGAGTC
TTCGCCGTGGAGGTGTCTTCGAGAAACTTGGTGCTTTGAAAAGTGAGAGGCGGGAAGTACCACCGGACTGCAAGGGATAGACTTGAGTGGTGGCGCTACA
TATGTGCGAGAGTTGGTGGTAGTCTCGCCAGCCCCGATACAGAATGCAGGCGCTGGATAATAATCAAACGAGCTCTGGGTTTGATTACCACAAATGTTTC
CTGTGGATCGGCGAGTCCGGATACTGTCAAAGGCGTCAGCGGCCCTGCCCCTAGTGCGATGACCACACCGCGACATATCGACGAGCTGTTGTGATTGATA
ACCTGCTATTCATTCGAAGTGCCTGTTAGCAACTTGTGACGAAAGAATGATGCATGTCTGTTAGAGCCAACACCAAGTGAGGTAATCATCTCCATCCAGG
CTATGATAGCCACCGCATTAGATATACCCCGTTACCAATTCAACCAGTTGAGGCGACTGGAGCTAGAAGCTCGAGCGTCCGAGTGGTTTAACTCACCTCA
GTTTCCAATTTCCGGTCCACCGCACACTTCAAGTCCCCAAGTCCGCTCCCAGTCATGGCGTCACCACGAAACCACTTCATTCGGGTGAACGACACCCCGA
AGACCCGCAACGTTGCTTCGGAGCCGCTCAAGTTCACCCTGCAATGGAGAAATCTGAGCCTCAAAGCCGAAGTGAAGAACCCAGCCACGAAGAAGACAGA
GGAGAAAGTGATCCTGAACGATGTCAGTGGATCGGCCCAGCCGGGCGAGTTGCTGGTGATCATGGGACCTTCGGGGGCTGGCAAGAGCTCTCTTCTTGAC
TGCATTTCCGGACGCAACGGCGCTGTTGAAGGCGACATCTTACTCAACGGGCAGCCGTGGACCAAGGCGACAAAGCGCATGGCTTCGTACGTCATGCAGG
ACGACCTCTTCTACGAGACGTTGACTGTCAAGGAGCATCTTATCTTCCAGGCGCGACTTCGCATGGGCAAGACGTCTACCGAGCAACAATACATGCATCG
AGTGGACGAGGTCATGGAGGAGCTGGGACTCATGAAGTGCCGTGATACTCTTATCGGTGGCGAGTCGCTGCGTGGGATCTCCGGCGGTGAGCGCAAACGT
TTGTCGTTCGCCACAGAAATCCTCACCAACCCGTCGATCCTGTTCGCTGACGAGCCAACTTCCGGTCTGGACAGCTTCATGGCGGAGACGGTGATCAAGC
AGTTGCAGCAGATCGCTCGTGACGGGCGAACGGTTCTCGCCACGATCCATCAGCCGTCGTCTGAGGTGTTCGCCATCTTTGACCAGCTTTATCTACTGTC
GGACGGGTCCCCAGTCTACCAGGGCAAGGCCAGCGAGTCGGTGGACTACTTTGCGTCGCTCGGGTACCCGTGCCCGCCGCAGATCAACCCCTCCGACTAC
TTCATGCGCCAACTTGTTGTCATTGACAAGGCGACTGACGAAGCTGGTGTAGCTCGAGTGGAATCTCTCAAAGGAGAGTGGAGGAAGCACCAGACACTGT
CGCGATCTGAATCGGTGTCACTGCAGGAAGGAGGCGGCTCTCAACTTGAGAGTACGCGCCTGCATCTGCTGGGTCAGATCAGCGTGCTTGCTCAGCGTAA
CACCCTGCGGTTCCTTCGGGACGGCTTTGCAGTCCGCGTTCCTTTCATCCAGAACCTTTTCCTCGCCGTGATCGTTGGTTTGATCTACCTGCAGTTGGAC
TTGGACCAGAAGGGCATCCAAAACTACACTGGTGCCTTCTTCTTCCTCGTCACCAACCAGATCGTCGTGACTGCAAACCCAGTGTTTGTGTCGGTTCCCA
TGGAGTTGGCGCTCATTTCCCGAGAGTACAAAGGGGGTCTCTACCACTTGATGTCGTGGTACCTGTCCAAGAACATCAGCGAGCTCCCCATGCAGATCAT
CCTGCCGATCGTGTTCTTCGTCCCGATCTACTTCCTCATGGGAATCGGCCACGGCTTCGAGGTATTCATCTACCTGCAGCTCGTCATGATCTTAATCAAC
AGCACGGCGATTGGTCTGGCCTACATGGTCTCGTGTCTGTGCCCGCGTGTCGACATTGCGCCGCTCATCGGTATGGTTCTGATCATGCCGTTCATGCTGT
TCGGAGGGCTGCTGATCAATTCGGACGACTGCCCCGACTACTTCGTGTGGATTCAGTACATTTCGCCCGTCAAGTACGGGTACGAGGCCATGATGAAGAT
CTTCTGGAACGCAGTTCCGTCCATCGCGTGCAGCACGGCGAATTGCACTGCTCGTACGGGTGCAGAGGTACTCGAAAGTTACAGTATGACTTCCCGATCT
GCGCTTGGGGACTCTCTTCTGCTGCTTCTCCTTAATATCGTCTTCCGTGTCATTGCATTCGTCGCGATCTGGTTCCAGCTGCGCCAGAAGAAGTAAGCGT
AGCCTAGTACCTACTAGGCTCTACAAAGCTCAATCAATCGGCATATCTTTCGTTTTAGTGCTGGCAGTTGTGATCGCCGTTGGCACATTGCAGATATATA
CCAAGCAGCATCTTAATTTTAGTTATGAGAGTACGACTGTGTCATTCACTCGTCCAACTTTGAGAGAACGTAAATGGATCAAGGACTGGCTCGCGTTCTC
GATTCGTTTTGCAGCATCACGTCGACGCTGTAAGAACAATGACGTGTTTCCAAGGCATTGGAAAGCGTGGTTGCTTGTAGGAATTGG