Description :
From Genome Similarity Track
Location :
Scaffold_552:3494- 4746
Sequence
1252 bases(100 bases per row)
GACTTCAACAGCCAGGACAGTACTGAGTACCTGGTGTACACCTTGATCGGGCAACCCTGGACGAGAGTGTTAAACACATCTAGGACCCGCATGACAGCAA
CCGCCTCCTTCTCGGCGATGTGATACCGAATCTCCGCGTCGCTCAGCACGCGCCCCGTGAACCTCACAGGCTGGAGCACTCCATCATACTCCTGGCCAAG
GACCGCGCAGGCGGCCCAGCGGTTAGCATGCGGGATAATCACAAATGGCTTGGTCCGGTCGGGGTGTCGCAACAGGGGTGTCGACACGATCTTCCGTTTC
AAGATCTCGAATGCCTCCTTCGCCCTGGACAGATCCCGGCCGGACTTCACTTGATTCTCCGTGAGCTCATACAGGACTGCAGCCACAACCGGGAAGTTCT
CAATGAACTTGTGATAGTAGTTGAGGCTTCCGAGGAATGACTGAACTCCCTTCAGGGTATACGGGAACGGCAGATCCTGAATACCCTTCGCAATCTTCGG
AGTCGCGCCCATTCCTTCGGCACTGATCTCGTGGGAGAGATACGGGATACTCAACTTCCCGAACTCACTCTTGGGCAGGCTGACAGAGATGTTTCAATAG
CGCAACCGGAATAGCAGCGCATTCAGGTCATCACACAACTGATCCCAGGTGGGCGATGTAGGAACTCCGTCCGAGGACAGGTCCCATCTGGGACGGCATC
GGGATGTTGCGTTGAAACACAGTTATCCCCTCCACCAGGACGGGAATACTAGCTCCAGCCTTCTCCCGTTCGGATTCATCCCGGACGGACGGGTCCAAAC
CGAGGAACTCGAGTACATCCGGGTCCACCTGCTCTTCTTCTTCCCGAGGGAGACGCACGAAACCCCAAAGGCAGTTGTTGATCACCGCCTGATATACGAG
TGGGGCATTCTTGAGTCCAAATGGCATGCGTACCCACTGGAAGTGTCTGAATGGGCAGATGAACGCGGAGATTAGCTTCGCACGTTCCGTCATCCGGACC
GCCCAGAATCCGCTCGCCCTGTCCAGACTCATGAACCACATAGCGGCTTCGAATCCAATCAGCAGATCATCGATCAGGGGCAACGGGTAGCTAGAAAGCC
GGATGAACCCATTAACCACCCGGTAGTCGATGCACATTCGGATGTCCACGCCATTCTTCTTGAGGCCGATCACAATCGGGGAAGCCCACGGCGACAGCGA
CATCTCGATTAGACCTGTTTCCAGCAGCTTTTTCAGGAGCTCGTACACCTTC