Description :
From Genome Similarity Track
Location :
contig_9:3494- 4557
Transcript NameFunction/comments
g2725.t1hypothetical protein

Sequence
1063 bases(100 bases per row)
TTCGCTGGACCTTGTAGGTCCCCAATCAGTTTCGGGCGCATGATCTTCATCACCCGGTCTTCGGCCAAGAACTTGTATAAGTCCTTCCGGTAAAATGCAG
ACTCCAATTGTTCCTCCGTCCACATCTTGCGATCTTCCGGGTCTTCGGCATCCGACTCCGGCGCTTTCATCTTGGTGCGTCCGGTCGGCGACCGCTTCTT
CGACGCTGATCGCGAAATCGGAGGAGTAGTTTTGGGTGAAGATCCTTTGGCTTTCGCCATCGGATCTTCATCCGGCGGATCACGATTCGCATCGCGATCC
GCGGGGGTCCCCGAAGGGACCTGGGGAGGGGGGTAAGGCTTCTCTTCTAGGTCCATTGCTGAACCTGCCTCCTTCTTCGTATCATCAGAGTCCCTCCCAG
TACTCTGCTGACTCGATGATCCTTGCGCAATCAGCATCATCGACGGCGATCCATCTTCCGTCGACGACTCATTCCCTGGTTTGATCTTGATCTTGACATC
CTCTTGGTTAGACTCACGGTGAAATCCCTGTGAGTCACCAGAAGATCCGGGCACGCGCACCATTGTGGCGGAGCGGGATCACAAATTGCTGATGTGACCG
GCACTCGCCAACGGTTGCCCGGACTGCCGACTGTCGGAGGGGGTACTCCGTTGATCCGGTGGATCTTGACCTTGTAGCTCACCTTGTGTACCCGACGGCT
TGGGCGGGTTGCACTCTTCCGGTACTCACGCGAGGAGTATCAGTGGTGATCGAGATCGGGGTTTGAGCTTGATGGGCTCTTCAGGGGATGGGGGGTTTGA
CAACTACGCGGATATGCTTCACGCAGTCGGTCGGTATCAGGTGTCGATCGTGTGTGGGATCGATCACAGGGGGTTGTTTTCCTTTGCGGGGTCCTTTACG
TTGCTTGCCGCCTCCTATGGCGGGGTCTTGATGAGTTGAGACAGAAGGGAGAGCGCGCCTAGCCAAGCGATCTAGGGGCTTCCACGTTTACACTTGATTT
CACTATGTGGGTTGTCGGGTCGTCGGGTAGGCCAATATACGGAATTCCGCTGGCCACTTGTGT