Description :
From Genome Similarity Track
Location :
contig_47:349382- 353102
Transcript NameFunction/comments
g9255.t1hypothetical protein

Sequence
3720 bases(100 bases per row)
TCCTGTTATCATTCGTGTCTTGGTTGAACTCACCGACCCGAAAACAGTGTTCACTGTGGGTAGGTTCGTGGTATGACTGAAAGTTACGGCGCTAACGTCG
TACCGGGCCGGAAACGTAACATCAACTCGACTACCTGACGGCAAGTAGGCCGAGTTGGCAAACGCAACAGTGTAATCCGTGACAATACCGGCCCAGTAAG
ATATGGGTGTCACCGTCGCCGATGGAAGCGTTGCGCTCGTGTAGGTGAGCCCAGCCACTGCCTGGTTTTCCTGGAATATGGCCCCGGTAGGGTGCCGTGT
GTGAACTCCAAAAACTCCCGAGGCTTGAGCCGCCGGATTGATAATATTGCCATACGTGATCGACACGCTCGTTCCGGCAGCAACGTCTTGGCCAGCAATT
GTAAGGCGGATATAAGGCGAAGCCACTTGCACTATCGTCGAGGCTACAGCAATGCCTCCCAGACTGGACAGTGTCGCGCCCGTGAAGACAATTGTGCTGG
CACTGAGAAGCGGGAACTGCAGTGCAATCACGCTCCCAACGCGTAGTGTGATGCTCGTCGTGAAGGAGATACTGTACGCTGTCGTCGTGCCGGCAACCAG
TGATGCCGCTGTCACTACCGGGCTGGAAATCGTTCCTAGAGTGATCATCGATCCCGGTACAGTAGCTGACTCGAGGGTCGAACCGCTTGCACTTTGCGTG
CGTATCAAATACGTGGAGGTTGTGCCCGAGCCTGTAGTGCCTGTAGCCAAGTTGGTTTTACATCCTATTAGTCTTCGCAGCTCAAAAACCTCCGTGTGTC
ATTCGTTTTACCTGGATTCGAGATACCGTCGAGAGTGAAGGCGATCGGTCCAGCAGTAGCGTCCGTACCGGCCACCGCGATCGTGACTTGTGCGCTGGCA
GGTGTTGCTACCATTGAACTGCTCAAGTCCAATCCCGAGGTGATCGTGAGCGTCGTGGAGGCTACGTAGAAAGTGGAGGGGAACATGACCGTGATCGTTC
CGCCGACAGGGACGGTAGTGCCTGTCGTAAAGGCCACGCCCACATTACCCGTGACGCCAGCGACAAGAGACGCAGGTGTGATGGTCGCAGGCGCGATGGC
TGCATATCCTCGCTCTGCGCATGACAGCCACAGCAGCAATTGCAGCCACCACATCGCATCCACCCTTTCAAGATCCGCCAACTTAGACTTACTTTAAAGA
TTACGCAATCTCTAGTTTAGTTTCTACATCGGTTTCTATAGATGTAGGAACTGCTCCCAAATGAAACGAATGGCGGGACCCCGGTGCTCTCACCACAAAC
CGGTATTCATGAAGTTATGTATATTACTACTAGTTGGAGTGCAATGAGGTAGCCTAGTAACGTACTATCTATCCGCTGTGTTTGTGCTGAAGAACTGCAG
CATTGATGGTTGGCTGTTGCGCGGTCGTAAGTTGTTTTTGCGTGGTCGGCCTGGTCTTCGCTTGGGTTTCTTTTGCTGTTGGCTCCCCTCATCAGTTGAA
TCAGGTGTCTCCGCGATGGAATCAGCTTGAACTGAAGCATCGAGAATGGCTTCCGGTACGCTCGGGTAGTAGTGTAGATATTGTGGTGGAATTGTGAAGT
ATTTGGCCGACAGCGATTTCAACTTCTTTTCCGCTAGCTCTTTGATCGGATGGCGTGGAAGCTGAACAGACGCAATTGACGCCTGGAGTATGTCTGTGAC
AGCAGGACCAAACAGTTCCGCCAAGACGGCCCTCCGAATACTGTCAATGTTATCAGATCTTAGCATTGCGAACGAGATTGACTCCGATTCCGGCGTACCA
ACGGTTTTGCGAGCGGTACAAGTGCCTTGATCAATCTCGAACAGATAGTTAGCAGTATACCCTGCAGGAGGCGGGAGGAAGTACTTGCTGAGCAAAGCGT
TCCAGTCCACGAAAAACGGCCTCTTGGAGTCGTTGTGGTCAAAGAACGCACTGTTCACGCCCTTTACTTTGTTTACTTCCTTCAAAAGATCCATCGGTGT
GTAGAGGTTCAGACCTTGAGTTGCCTTACGGCACCAGGCAATAACGCGGTCCGCAACGTTATGAGAATGACCAGGAAGCAAAAAGCACAGAACAACTTTT
CTGTAGGGGAACACTATCGAGAGCATTGCGAAAAACATCAGAACGGCTTTGGACTTATTTTGCCCAACACAGTTGTCCAGCAAACTGAAGCTGACTTCGG
CAGCAGGCAGACAATTACTTGCTGCTTCTTGCACCTTTTTGAGATGGTAAAGCAGCCTTAAGCTGCAGAGGGCATCTGCATCTTTACCCTGAGCTCTCTC
ATCGTAGAAAAAGACATGGTTGACGCTGTTGCTGATGTCTGCCACGACAAAGTTCTGCAAAATGAGGTTGCTGTTATAATAGTCGATCGACGGGCGAGAG
TGGCCAAAGTAAGGCATCGATATACCACCACCATAGTCCTCCGCTTGAATTTGCACCCGACAGTGCTGATTCGAGGGACGTTCGCCTGACTCGGCTGTAG
CAGCATCGAAGGCGTCATCCACATTTTCCATACAGTCCACGTTGCCATCGTTGTCATCGGCTGTATCCGGAATGATTTCACAAGGCAGGTACTGCTCTGG
TGCATGGAGGGCCGTATAGTTTCTGATGAACGACGAAACAAATCGTCTTTGGGAGATAGCTTCAGCAAGATGCATTTGCTTTTGGAGAAGAAGACATTTC
CGTTCATCAGGAGTGATATCCTCTTGTCGAAGCTGAATATCTAAACGAGTGCAGCAGTCACAATCGTCTTCTGTCGTTCTCGTTAGACGGACACCGGGAT
ATAATTTGCGGACGTATTGAATGAAACGAGAGTAGCTCATTGTGCGAGCGCTGGGATCATCGCGCTTGACATCATCTTGATATCGCGCATGGACCACAGT
CCAAGTTAGTCCTGCTTCGTTGAAGAATTGACGAGGTCGTCTATGGGGGCAAGGAAAGCCGTCATCCAGTATCCATGTCGAGCAGTGTGTCTTAAACGCA
GCCAGGTCTAAATCACTAAAGGCATGCCACGGGGCAGCAGGAGTACGTCGGGTGTGCAGTGTATCAACCCCTTCCTTCAAAACTGTCCTTAATCTTGCGA
TTCGACTTCCTCCTACGGGAAGAATGGCACGAATAACTCGTTCAGACAACCCTTGCTGAAGAAGCTGCAAGATAGCGCCCTCTGACTGCTCCCATTCACG
TCCTCCAACTCCTGTTTCCCAGGAAGCCCACTCACGCCTGATTGCGGCGATCTTCTCCTCGCTGAGGAGCTCAACAGCGCGGGCATATGCCGTCTCCTTG
CGATCAGCTCGTTTGCGTCTCTTGCGTGGGGGTATAGTCGATCGGGAGCCCCCTGTGGCTCGAGATGACATGCTTGGCGCTGCTTCGAAGGACGCTAAGT
GGTTAAGGCCTCGACAAAAATAAATAACTCCTCAAGCGAAAGGTATTTTATGCGGGACCCCGGGGTCCCGCCATCCGTTTCAAATGTATAGCGCTGAGTT
CGAGCACCTGGACTTGAGCTTTCTTTCGCAGCGACGCCATCTCGCGCCCAGGTTCATGTTCAGCGAGCGGGTGCAGCTGTTCGCCGCCACATCATTCGCG
TCCTGCGCGTGCATGACACGATCGAGACGTCCCATGATTCAATCAGCGCCCCACACAGCAAACAGATTATACAGCCCACCAAGCCATGTTTGGCCGCGCT
GTCCAAGAGCAACAGTCTGC