Description :
From Genome Similarity Track
Location :
contig_29:349373- 352123
Transcript NameFunction/comments
g5793.t1hypothetical protein PHYSODRAFT_344687

Sequence
2750 bases(100 bases per row)
TCGGTAGAAAGAAAATAAAGTTGCAATTGAGGAAGGTGCCAACGTTGTGCCTCCCACATTGTTGTCACCAACGCTTATAACTAGACATGGACCTTACACG
GCATATTCACATCTGTGACTCGATTCAAGATAGCTTTCAAGCTGAGCATTTCGTTCAACATCGAGCAATGTGCATATCCACCTCACCCTTCAATCAGTGG
TAAGACACGACATAGAAAAGTGCTGGGGGTGTGCCAGAGATGAAATCGTAAAATCCTGTACGACTTTACTATGGAAAGCTACGTGTGTACTTAAGCCATC
CCTCGGGTCGACTTCTATTGGCGACTCGATGGCCTCAAGGAGTTACTTGGCCGTGGGTCTGTTAGACGAGTAGTTCTGCAAACACTGTGTTTTTACTCTT
TCCAGTTCAGCTGGAAGATCTTAGATAGGTGATGTCTTCAAAGGAAGCCCACGCTCCAAATGTCAGCCTCCACTGTGTAGGACAATGATAATAATATCTC
GGGAGCATGCGATTCCGCCTTCAAAGGATCTACTTTTGCAGCCGGCGACACTGCTCCATCATCGAAGTCAATAAGAAACCACTGCCGCCTTCGAGGTACC
TCAGCACACTGTCCCTCGATGCATCAGATTGATTGCATGCAGTGCCACCAGCGCCGTCAGGAGCTAGCGGACATTTTTAGGCGGGGGAAGTCGACCAACG
GATACCAGCGTCAGGCTTCCTTAGCTTCACAACGTTCGGGACTGAATGTCTCTTTCATTCGCTCATGCAGCATTTTCAAATGACTAATTATGCCGTCGCT
GGGCATGCTCGAGGGATACGTCTTCACCACACAATCATCTCCACACCATTGACTCTTTTGACAGTCCTGAACTCGTGTAACCCAGCGGTCGGAAAAGTCG
AAAGGTTGAGCATGGCGAGAAAGAACGAAAGCCGGCCATTGAGATCACCAAATCGTACATTTCAATGATTTCCACTTTTGCACCACGCTCCGTCATCTCG
TCTTTCCGAATAGCTTACCAAGCACACTTGCAGTCCCACCGCAGCGTAGCCAAACACGTACGGCGCAGCGTCATATCTCCACGTTAATTTCTCACGCAAT
TCTTTAAGCGGCACTTCCAACTTGCCTTGCTTCTTCCCGTAAAACACGCACCATTGCTATTCTTGCAGTAGAAGCAGACATCTGGAAAACGAATTCGTGC
TGCGACGAAAGTTTCCGTTTGGCACACGCCTCAGGAGTACCGAAATGATGGGGTCCCACAAGTGATGATATAGTTCTTCGATTTTATCCTCGGCGCCAGA
CCTAGGGGGGTCAACAACGGAGCCCACGAGAGTCGCAGTTCGGTACGAAAGTTTTTCACGCGGTTCGAGGCTTGTTTCGTGATGCTCTGCTCTGGTCTCT
TTTCACAGTACCTATCTAGCAAAGCTAGCACCTTATGCAACTATTTCGCTGCGCATTGGCTTTGCTGCGGATACAGATCCGCCAGCCAGTTTTAACATTA
CCGATGCTGGAGAGAACAGTGATCTTCGACAGTGCCATGCCTTGCCTTCCTACCTTTTTCACCAAAACCACCCATACTTGTCAAGAATAACAACATGCTT
TTGCGCGGTTGTGGGCCTCCTTGTTCCCGAGGAAATCCTCGAAGGGCTTGATAGCCATACCAACAACAGCTCTATTTTTTGTTTGCCGTGGGAGAATAAT
GTGGTTGCCTGCGTTGCCGCTCTTCGCTGCCTTGGTGACTCGTCGTCCCGTGTGCTCATTCGTGGAAAACCAACCAATCGCCACCTGAATACTCGCTCGC
TTCAACTTGCCAGAAGGCTCCCGAGGCTCGCCTTTGAAGGTACGACGACAAGGACGTACCAGAACAAGTGTCGTCTAGTAGACCCTAGCAACTATTGCCC
TTTGCTACTGCAGTTGCTTTTTCTTTATATTTATTCGAGTTCGATGGAGAGTACATAGCTAGCTGCACCCCTATAGGAGGCGCAACTACGGGAAAAACAC
CTACACATTGGGTCCGTACACTGACAGGTCGTTGCCCGGCAGGATGAACTGCTTGAAGTTCTCCTTGAACGACTTGGCCAGCTTGAGCGCCGTCGCGTCG
AACGCGGCCTTGTCGGTCCACGAGTCCTTCGGGTTCAGGATCTCCGACGGCACGCCCTCCACCGTCGTCGGGATCTCGAAGCCGAACAGCGGGTCCTTGA
CGAACGTCGCCTGGTTGATGCTGCCGTCCCACCGCGTCCACACACTTGCGCGTGTACGGCAGCTTCATGCGCTTGCCCACGCCGTACACGCCGCCCGTCA
GCCGTGTTGATCAGGTACACGTGCGTGTTGTGCTCCTGTAGCCTTCTTCTTCAGCAGGTCGGCGTACTTGGTCGGGTGCAGCGTCATGAACGCCGCGCCG
AAGCACGTCGAGAACGTGGCCTGCGGCTCCGTGATGCCGCGCTCCGTGCCCGCCACCTTGGCCGTGTAGCCCGACAGGAAGTGATACTGCGCCTGGCCCG
CAGACAGCTTCGACACGGGAGGCAGCACGCCGTACGCGTCGCACGTGAGGAAGATGACGGCGTTCGGGTGGTTGCCGCGCGAGTTCGGCTGGTGGTGCGG
GATGTGGTAGATCGGGTACGACACGCGCCCGTTCTCCGTCTTGCTCGAGTTGAAGTAGTCGGGCTCGTTGTTGGCGTCGATCCAGACGTTCTCCAGCATG
GCGTTCGGCCGGATGGCATTGTAGATGTCCGGCTCGTTCTCCTTGCTCAG