Description :
From Genome Similarity Track
Location :
scaffold_17:349373- 351381
Sequence
2008 bases(100 bases per row)
TCAAGGTGAAGACCAAGGAAGTTTGTCTACAGCTTGAAAAGGTGAATATCATGGGCGGCGTTTTCATGTCCAAGGAGTATGACATCCTCGCGGTCAATTA
CGTTTTGGACATCTCGAACGTCGACTCAGACATGAACACGGACACAATCCTGCATCGACTCTTCAGCATCAGGTGCAAGCCGATATATGACACGTTCCGT
GAAGTTAACGTGACAACTGATTTGACCTCGGCGACGTGGCGAGTGTACTTCCTCTCAAACACGTGTGCTCCACCACTTGTAGTAAACGGCTCAGTCTGTG
ACCAATTCCTGGTTGACAACAAACTACACCCAATTCACGGAAAGAACGCGCCGTACCAGTCCGAGCGTTTGCCGTTGCTAACGCTCGCTGCATGGTATTC
ACCTGCTCACGAGCGATGATACCTTCCCGTGTCCGGGTCCTCTTGCCGAGCCGTCGCCGTCGCAGACGCCGAATCCACCGAGAATCAGTCAAAGACGCCC
ACACAAACGAAGACGACAAGCCGTTGACCTCGCTGCAAAGGGCAGCCGAAAAGACTAAGTAGCGCAATAGAAGGATTCACCACGAAGTTCCGCATGGAAT
ACCTACTGGTGCCGACCAAATCGCCCAAATTTCGAGTGACCGAGACGACGTGCTCTCAATCCCGACATTTGATAACGCAAATGGTAAGTTCTCACCGCCC
GACAGTCCATAAGATAAAGGCACCGCTATTGCTTTTGACAAATCACGATAGCTCGAACGGTTTCTCGGTAGTCCagaacaagaagaagctcAGCCGAGCT
AATGTTGATTTCACGGCCGTGTTTACAAAACAGCAGCCACAGCCGCTCAATGGCATAGCGAATACGAACTTCTTTCGGGCGCTTCAGTCGATGAATGTCG
CATTTGTGGTTAAGCACGCCACTGCGGACAAGCGGCGCGACGCGGCGCGCGCAAGCAGATCGTATCGGTAAATTCGAAGTGACCCGACGCAATAAACACC
TTATCTGAGTCGGCATTCTTCGTTGAAATACACCACACTAGAATCAAGAAGGCTGCGAAAGCAACGCCGATTCTTGAGGTAACCGAGTCGATGATTAACG
ACGAGAATACGGCACTGCTTGACACGCTGCCTAACAAGTTTGATGAGGCAGATAGAGCGGTGCTTAGCATGGTCAAACTGATTAAAATGCGACAAACCCG
GATCATATTGTAAAGTCGGCTGCTGCTTGTCCGCTCGCGTTCAAAAGAGCTTTGTCGTTTGCGATGGCAGGCAACGGCAGATTGATCGGCGATCTCGCGT
TGTTGCACTTGATCAACCGTATGATGAGCGCGACGTATCCCAACGAAGACACGACGTTCTTGGCAAAGTGGAAGCATATCATGGAAATGTCGAATTACCG
TGACATCTTCGAGGCGTATGCCAGGTGATGGAACCATACGGACGAAGTCAGGAGCTGTCACGTGCGTCGAAGGTGCTCGGCATATTCGAGCTCGCGCTCA
TGTCGATCGCGCCAAAACTGTTTGAAAATTATCACTGGAATCAGTACCTCACTCCTCAACCGGTCGAATGGATCCCAGCAAATCACTCGAGCTTCCTGCA
CCCGAACACACTACTGTTTTTGCTGCGGTCGGACTCGTCTTGTTCTGCATGCAGCAGTGGCGAGAAGTACACTGGCAGGATCATCTGCTTGATGACTTGG
AGGCGCTGCGCAAGCTCGATGGCTGCTTCCCGGTCGAGTCATCGGTTCTAAAGCTTCACGTAGACGCTGATGGTCTGGTGTTTACAGTGTCAGGCGGCTT
GCCCGCTCGCTGCTAAAGCTGTATCGGCCATACACCACGCCTGGAACAGCGTGTCTTTCATGACCGTGAACACGAATGGTGCCAAGAAGAACGGACACCT
GTTCATCGACAACCTTCATTCTAGGCACTCGATATCGTGCGTCCAAGAAACCAAGTTTGGCGACGCACAGCATCTTTCGACTTTCAGCTTTCATCTCGAG
TCAAGCTT