Description :
From Genome Similarity Track
Location :
Scaffold_451:3493- 5040
Transcript NameFunction/comments
Pytve_DAOMBR484fgenesh_masked-pve_contig_451-abinit-gene-0.30Amino Acid/Auxin Permease (AAAP) Family

Sequence
1547 bases(100 bases per row)
CGTGCACGGCAGTGTAGTTGTAGTACAGGTCGTTCCCGTACTCGGCCGGGCAGAAGGCGTACTTCACGCCATCGTCACTCGGCGCGAAGAGGTCCTCGCC
GGACGTGTACGTCACGTAGACGCCGAGCACGCAGCACACGACGACGACGATGATGCCGGGGATACGCTCGTACATGGGGACCTTGTCCCAGGCCTGGATG
TAGTAGTACACGATCGGCAGCACGATGCAGTTGACGGTCATGCCGGACGCTCCGATGAAGTCGCTGAGCGCCGAGAAATCGTCTTGCAGCACGATGGCGA
TGATGATCAGGACGACAACGATGGCCACGCGGAGCAGGACGTACTTGATGGCGTTGGCGCCGCGGTACTCGGCGGCTTCGATGGCGTGCTCGTCGACCTC
CTCGCGGTCGACAGCAGAGACATACGACACCTTGGACGTGCGGGTCTCCTTGACCACACCACCCTCCATCGGCGTCGACGCGTCGGCGTAGCTGACAGCG
TTCTCAATGTCCGCCTCGGTCCGGGGCTTGTGCATGCCGAGCACGAGACGCTCAGCGATGTAGAAGGCCGGGTTGGCGATGACGGAGAAGGCGATCGTGA
TGTGCAGCTGCATGAGCAGGTAGGCCATGACGACGGCACCCCAGTCGGACTTGAAGCCGAGGCCCGTGAGGCCAGTCTCCGGGTCCGGGTAGATGGTGAA
GAGCAGGTTGCCCGAGNNNNNNNNNNAACCGCCGAGTAGCCGGTCGACGCGAGCGTCAGGAAGAGGATCGAGATGAAGCCGACCGTGACGCCGACCACCA
TCGGCATGCGCGTCGGCTCGCTGTGCTGGCGCTGCACATCCAGCAGCACAATGCCGGCGCCGTACGCGAGCGAGAGGTTGCCGAAAGTGCCGGCCACCTG
GCGGAACGAGAGCTCAGGGAATGGCACGGACGGGTGGCCGCGCATGCCGTACATNNNNNNNNNNAATGCCGATGACGTCGGCCAGGATAGTTCCGAGGCA
GCCGGCAAAGGCCATCGCGGCACCCTCCTTGAGCGTCGGCACGAGGCACACGGGAAGCACCACGAGCGCCATGAAGATGATCCAGACCGTCTGGCTGAAG
GCGTTGGGGAAGAGGCCGTCGAGCAGAGAGCCGCCGAGCACAAAATAGAGGCACGGGATGAGCAGGCACGAGCACATTTGCGAGACGACGCTCAGGTAGC
GGCCCCACTTGCCCATGCACCACTCGCCCATGTCGCCGAACGTTTTGACCGACTTTGGCGCGAGAAGCATGACCTTGGACATGCACACCGACGAGTAGAT
GTTGGCGAAGGCCATGAAGGCCATGGCGATGATCGCGATCGTAGGTCCCGCGCGGGAGAAGTTTCCAGGCATACCAAGCGTACCAACACCGTAAATGCAG
CAGAAGAGATTGAAGGCTGCCTTGGCGTCTTCGCCCGTGAACCACCGGCGTCCGGTCTTGGCCATGTTGAAATGCAGCGGCGGACTTGGTCGGGACGGCG
AGGAGGAGGAGCTTGACTTGAGCGGTCGAAGGCGAATTCGAAAGTGA