Description :
From Genome Similarity Track
Location :
scaffold_9:3493- 4554
Transcript NameFunction/comments
g4479.t1 hypothetical protein PHYSODRAFT_424253

Sequence
1061 bases(100 bases per row)
GACCTTGTAGGTCCCCAATCAGTTTCGGGTGCATGATCTTCATCACCCGGTCTTCGGCCAAGAACTTGTATAAGTCCTTCCGGTAAAATGCAGACTCCAA
TTGTTCCTCTGTCCACATCTTGCGATCTTCCGGGTCTTCGGCATCCGACTCCGGCGCTTTCATCTTGGTGCGTCCGGTCGGCGACCGCTTCTTCGACGCT
GATCGCGAAATCGGAGGAGTAGTTTTTGGTGAAGATCCTTTGGCTTTCGCCATCGGATCTTCATCCGGCGGATCACGATTCGCATCGCGATCCGCGGGGG
TCCCCGAAGGGACCTGGGGAGGGGGGTAAGGCTTCTCTTCTAGGTCCATTGCTGAACCTGCCTCCTTCTTCGTATCATCAGAGTCCCTCCCAGTACTCTG
CTGACTCGATGATCCTTGCGCAATCAGCATCGTCGACGGCGATCCATCTTCCGTCGACGACTCATTCCCTGGTTTGATCTTGATCTTGACATCCTCTTGG
TTAGACTCGCGGTGAAATCCCTGTGAGTCACCAGAAGATCCGGGCACGCGCACCATTGTGGCGGAGCGGGATCACAAAATTGCTGATGTGACCGGCACTC
GCCAACGGTTGCCCGGACTGCCGACTGTCGGAGGGGGTACTCCGTTGATCCGGTGGATCTTGACCTTGTAGCTCACCTTGTGTACCCGACGGCTTGGGCG
GGTTGCACTCTTCCGGTACTCACGCGAGGAGTATCAGTGGTGATCGAGATCGGGGTTTGAGCTTGATGGGCTCTTCAGGGGATGGGGGGTTTGACAACTA
CGCGGATATGCTTCACGCAGTCGGTCGGTATCAGGTGTCGATCGTGTGTGGGATCGATCACAGGGGGTTGTTTTCCTTTGCGGGGTCCTTTACGTTGCTT
GCCGCCTCCTATGGCGGGGTCTTGATGAGTTGAGACAGAAGGGAGAGCGCGCCTAGCCAAGCGATCTAGGGGCTTCCACGTTTACACTTGATTTCACTAT
GTGGGTTGTCGGGTCGTCGGGTAGGCCAATATACGGAATTCCGCTGGCCACTTGTGTCTTG