Description :
From Genome Similarity Track
Location :
Scaffold_164:34928- 36480
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_164-snap-gene-0.27Gene of unknown function
Pytir_DAOMBR486maker-pir_contig_164-snap-gene-0.17Gene of unknown function
Pytir_DAOMBR486maker-pir_contig_164-snap-gene-0.28Gene of unknown function

Sequence
1552 bases(100 bases per row)
CTACATGCTCGAGTATGTCTTGAGTATGGCGGGGAGTAGGGTCGCTGATTTTCCCTGCAAACAGCAGTCTCTTGTGCCTCGCGATGAGCATGTTCAGTGC
TCCGTCGCGATGGAGAACGCGCAGCTTCTTCAGTACCAACGTCGCACCGCGCGACGCAATTCCACGGTTCTTAAGAAACGAGATAGCCTTTTCTTCCACG
TTGACTCCAACAGTCATGACGTTGTCGTGATACGACGGAAGCTGCTCGTCTAGCGAGAACTCCTCCTCGAGAAAAAGCTTCAAGAAAGCGACAAGCATCT
TTCCGTCGGACTTTCGCTGCTCCTCGCCGATGATGGTCCACAGACGTTGCTCTTCAGTGTACCACTCGTACCAAGCGGCTCGCAGGTGAGTGGTAGATAC
GCGCTTTCGGTGCTTGTTGTTGGCTCCGCTTCTTGCTCTCTTGGTCTCGTCGTCATCTGCTGTGCGCTTGCTCTGCCTCGCAGGTTGAGCAGTTTATCTG
GCATTTGTCTTGAGCGCGTCCAAGCACTGGTCTTGCTGCTTCACGAGACCGACTAAATGGTTAATAGCAGCAGCTTGATGTCGGATGGTTTGCTGCTCCC
CCGTCTTTGCGTATGGCGCTGTGGCTTGTTTTGTGTCTTTGTCTGTTGCGCAAGCGCCGCGCGCAGTAGTAAGGTGCGACGACCATGCGAGCAAATCTGC
GACAGAGCGCTGGGTGTCGAGCGCACTCGTCTCTATCCGCAGTACAGCGGGGCTGTTCGGGTTCAGCTGCTTCAACAGCAGGTAGTGCGTCAGCAGGACG
GCAGTGAGGACGTCAAGCACCCACTAGCTCACGTTGCACTATGCACGGCCAAGCCCACGGCACGACGCGAAGAGCCGCTCTTGGACGGCTGTGATCTGCT
CTCGCGTTTACGTGTCGAACGGCGTCAAGTCGGCGAGCGGAACGCGCTTCGACGTACTCCACTCGCTGAGGACTTTGGCGACCTTGTGGTCATCGGCACG
CGTGTTGACCACGTAGCTGAAGGCTTTGTTCGTGGTGCTTGCGTTCCAAGCACCACAATCAAAGATCCAGTGATCGATCAGCTCCGCTGAGCCGTTAGCG
TGCTGGGTACCACCTCGTCGAAACGAGTGAGAGGTAAGTTACTGCTCAACGCCCGCAAGCTCGGCGATGAGGGCGAGCAGACGATTGACATGGCTGTGTA
TTGTGAGCGCAGAGGAGGTGGTGGCACCGGAGGGCAGGAAATCGGGCGTGGAGTTGGGGTTGTCGAGAAGCTCGAGCAGTAGTGTCTCGGAGCCGAGCGC
GCCTGCGACGGGCTGAGTTTGTACAGGGAGGTTGCTGAGGAGGTCGGCGCACGGTGCCGTTTGCGTTGCGAGAGCCAGCGCGATTGCAAGCAGCGAGCAC
ATGGCAAAGTCAGCATCGACGAAGTGCGAGAGACCTTGCTTCTCGCACGTCTTTATCCGTATGAAGCGTACGAAAAAGACGTCGCCAGCGTCGACTGAGA
CATTTTGCTTGTGAACGTGCGTCAAGTCTGACGCGCGCCCAAACATATACCA