Description :
From Genome Similarity Track
Location :
Scaffold_96:34921- 39958
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_96-snap-gene-0.31Ornithine decarboxylase 1

Sequence
5037 bases(100 bases per row)
TGCGCTTCAAGTCGTACGGCTCGGCGGTGATCGATATCCCCGAGCACCAGCTGCTCGCCGCCGCCGTGGACGAGGAAGAAGAGGGTAGCTGTAAAGGCGT
GTATAGAGACGACGACAAAGATGTGAAACGCCCCGATGATGACGACCTCGAAGGGGGTGAGTGCAAGCTGCTGCTACGAAAGCACAAGAGCGCGGCGATC
CCGTGCCCGCGCTCGTGGTGGTCGTTCGTTTTTTTCAGCTGGTGCGAGCCCCTCGCACGGCTCTGCGAGCAGCGGCCNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNGTGAAGAAGACACAAGCAAGTACTGCGCCGATCAGTTCAAGAAGGTGTTTGCGACGTCACACTCGCTTCTGTTCGCGGCGATT
CGTACCCAGAAGAAGCTGCTCTTCTGGAGCGGCGTGATCTCGCTCGGTGCGGTCGCATGTGAGCTTGTGGGGCCGATTGCAGTTTACAATATCGTGAACG
CCGCGGCAACGCATGAGATGGCTACAGTGTACTCGAAAGGCGCGTTCTGGACGCTCGTGCTGCTTGGGTCACGTTTCCTGCGCTCGTATTCGCTTGCGTG
GGCGGATTTCCTGCTGAAGTTCGTCAAAGTACGCGTGTCGGGTGCGATGCATGTGCTACTGATTGAGAGCGCGCTCGACACGAATCGATTCTACCAGCGG
TACGTGATTTCCAGCACAGCGAATCTGTTCACGACCGACATCTCGAACTTTGGGAGCGCGTTCGACATGATCCATCGACTCTGGATGGTGCCGCTCGAGC
TCTTTGGGCTCTTCTACATCTTCCGCTGGGTTGCAGGTCGCGTGATCACTGGGATTTTAATCGTGTCGTTTATTATCTATGCGCTGATCCAGCTCGTGAC
GTGGTCCGAATCGTCAATCTTTCGGCAGTGGTTATCGATTTCGGACCAGCGCTTTGGCATCCTCGAGCGAATCTTCAAGCACATCGTTGCGATCAAGCTG
AGCACGTGGGAAGATTTTGTGCTCGAGCGCGTCATGGCTGTTCGCAAGACCGAGCAGTTCGTGCTCAAGCGCCATATCCTGGTACGAACGCTTCGCTACA
CGCTCACGTGGATTGCGCCGTCTGTGAATTTGATCGCGACGGGGGTTTTGCTTGTGAACACCCCAAACTTCGCGTTCGCGTCCCCAGCATTCACCTTCAG
TGCAGTCGCAATTTTCCACGCGATCAACGACACTTTCGGCATTGCAGTGGAAGTGGTTCAAGTGTTTTTCCAGCTGCGAGTGTCACTGGATCGGATTTAC
GAAGCGCTGGAGATCTCGCACATACCCAGCAGCTCAAGTACCAGGTCGCGAATGCGTGGATCGAGTGGGCATACTCACTCCCTTGGTGCAGCCAGCGAAG
AAGCGGTTGCAATAGCGGGAGCGAGTTTTGCGAATCCAACGATACCAGAAAAGGATCTGCTCTCGTACGTCAATCTCCGGGTCAAGCGAGGCGAGTTCGT
TGTTATCCACGGAAAAGTTGGCTGCGGCAAGTCCGTCCTCCTGTCATCGCTGCTCGGTTTTCTTCCGAAGCAGCGGGGCGGCGTGTACCTGAATGGCAGC
GTCGCGTTTTGCTCCCAAGTGCCATGGATCCAGTCCATGAGCATTCGAGACAACATCTTGTTCGGGAAAGCGTTCGACGAAGTCCGATACTGGAGCGTGC
TTGAAGCTTGTTGTCTGCTAGAAGATTTGAAGAACCTGTATGCTGGCGATCGCACAGTCATTGGTCCCCATGGACTTGTGAGTATGTCGGGCGGACAGCA
ATCGCGAGTGGCGTTGGCGCGAGCATGCTACTCTGATGCTGACATCTACATCCTGGACGCGCCACTCGATAGTGTTGACAGCATCGTTCAGTGTGAGATT
TTGCTCAAGTGCATGGGGCAGCTGCTGCAACAAAAGACGATCATTTTGACAACCCACAACCCCGAAGTGATCATGTGTGAGTACGTCGACCGAGCGATTC
TGATGGAGCAGATGGTGGTTCAAGAACCAAAGCTGGGTGACCGCCCGGTTCAGCGAATGTCGCGTCGAGCAGCGAGTGAAAACCGACCAGTTCCAAAGGC
TTTCCAGTCCAAGCGGTCGCTTCTGCTTGGCGAGTCAGCTACGCATGGAGGGATACTGGGGAAACGAAGAGAAACTTCGGCTTTGGTGCCAACAGCCGAG
AAAAGTCGATCTCTTCGGGTGAACGAGTCGATTATTCTGAACCCATTCGTTCTTCAAATCCAGTCGGCGCCGCGATTACGACCATTATCAACATCAATAT
CGTCATCGAGCTTTGTAAACCATGCGTCCTGCGCGTACCGCAAGAAAGGTTGGGCGAACGTGTTGAAGGAGTATCTCGCGTACACGCAGAGCTTCTCACT
TCTTTGCATCGTGGTGTTTCTCCATCACGTCACCCAAGTGCTTTCGACCATGAGCGTGTACTACTTTAGTCGCTGGATCGCGTCTACAAGCAGAACTGAT
GATTCCCTAGAAGCGCTTGCGCACACAATCGTGCTCTTTGATCGCTATATGTGGATCGTGGCTGCGAGTTGCGTCGCGTTTCTTTGTGCTGCGTTTGCCA
CATTTTCGTTCTCTCTCTGTGCCGCGGACAAGCTCTTCGAGTGCATGACGTCGGCGCTGGTGCACGCTCCGATGCGCTTCTTCTCAACAAACTCGGTCGG
GAGGATCCTGAATCGGTACGCGCGAGACTTGAAATCGGTCGATTCCAGTCTTCAGAGCGTAACCTTCGCACTGCTGCGAAGCTTCTTCAGCTCCTACTGT
TCCTTGTTTGCGTCGCTCGCGTGGCTCAGTGGTCACATCCTCAAAGTGAACAACGTGAATCTGCACGATGATGGATCGTCATCGGAGTTGCATTGGGCGA
TTTGGTGGCTTATGATGATCCTGATCGTGATTGTCACGACTGGTATCCTCGGCTCGTTTTGGCGCGATGGTATCCGGTCAAACAAGCCCAGTGGTGAGAT
CTACCTGATGTTCCGAGAAACATTATCTCCACTTTTCAATTTCGTCACCGAGTCGATGAGTGGGAAGACAACCATCACTTCCTTTGGAGCTGAGCAGAAA
CTGAAAGTCGCGAGTCAATATGGAGAGAAAGTGGACGAAGGGACTCGGATTTTGCTGGCGATGTGGTCGTTCGAGACGTGGGTTGCGATTCGCTGCTTGC
TCATGGAGACTTTGTTGACGAGCTCGCTTTTGATCGCGCTGATCACGTTTGGTCACGACCCGTCGTTCTCGAACCAGCCTGCGACGATCGGACTGCTGCT
GTTCTTGCTGCTGAACATCCGCGATGATCTGAAGAACAGCTTTGCGAATTGGAACCTGCTCGAGAAAGACTTGGCGTGTGTTGAGCGCATTCTAGAGTAC
ATTGACGTCGAACCGGAGGGAGCGCACAGCCAGAACCAGCTACCGACAGACCCTTTCTGGCCACGCCATGGCGTGATCACATTCCGCAACGTCTACTTTC
AGTATGACGGCGCAGTCACAAATCGTCATTACCAAAATCACATCAGCAACATCAGTGCTCACAACAGCAGTGCTTTGACTGGGTCTATGGCGTTGAAGAA
TGTGAGCTTCCAGATTGAAGGAGGGCAGAAAATTGGCGTGGTCGGGCGGAGTGGTGCAGGAAAATCGTCGTTGGCGATGGCGTTGATGCGGGTGAATGAT
CCTCTCCGCGGTGCGATCTTGGTGGACGGTGTTGATATCACACACATGCATTTGAAGACACTGCGATCGAAGATCTCGTACGTGCCGCCAAACCCGGTGT
TTTCGAACTCGTCATTGCGTGAGTACCTGGACCCAATGAGTCAAGTCGAGGACGCCGCGCTCTGGGAGATTCTCAAGAGAACCGGCATCGAGATGTCGAT
TCTGAAAATGCAGGCGTCTCTGGATGCGAGCATCATGAAGATGGTCTCGAACTGGAGTACGGGCGAGCGCCAGCTGCTCTGCTTATCGCGAGCGTTGGTG
TTTCGCTCTCGCATCGTAATCCTTGACGAAGCGACGACAGCTACCGACCAGGAAACAGACTGCCGCGTCCAGGACCTGGTGTACGAGATCCTCGACTCGA
ATACGACTTTACTCTGCATCGCGCATCGGCTGGATACAGTGCTGGAGTTTGACAAGATTCTCGTCATGGCGGACGGCNNNNNNNNNNNNNNNNNNNATCG
AGGATTTTGGTACGGTACAGGAACTCGTGGAGTCTGGTGACGGTGTGTTTTACAACCTCTTGGAGAGCGCGCAGCTCGTGTATTAGCAACTGAAACAAGA
ACAAGGCAACCACAAAGAAGACCTGCAGTAGAATTTGTCCGCTCATAATCAAGGAGAAGTGCTCACGTGAACAGGTAACATTTCATTGATGATATCTATT
TACAGTGTCTCGCTTTCTGAGATCAATCAATTGCTCATGGCGTGTTTGTGTCTTCTTCAACCTCAAGGTATATTTTACCAGGGAGCTGGAACCCGTTGAA
CGTCGAGCCCGTAGCAAAGCCGTACGCACCCATGTGCGGGAACGTGATCCAGTCGCCGATCTCCAGCATGGGCAGCAGCGTTTCCTTCGTGATGAAGTCT
TTACCGTCGCACGTTGGACCCCAGACGCTCGACGGCACCACCACAGCAGACTCGTCACTCTCATCTGACAACAACAAACGATTTGGCTCGCCGTTGATCA
CAATCGGGATTGGGTCGTAGAGCTTGAACAGATGCGAAGCGCTGAACGAACCGTGTGCGCCATCGTTCACAAAGTACATGTAGCGAGGCACGTGCTGATG
GGTTTCGTTCTCCGACACCACGCGCGCAGTGAGCGTCGGGTCCGTCTTGCGACCAACGACATTGAGGTTGAGCGTCGCGCAGGACGAGACAAAGTACCGC
CCCGGCTCCGAGATGATGCGCACGCCCGAGGATTCAGGAAAATGCTCGGTAAGCGCGTCGTTCACGGCTTTCGCAGCGTCCTGGACCGTCACGGGGCCGA
GGTCGTCGCCGGCGAAGCCACCACCAAGGTTCAGAAG