Description :
From Genome Similarity Track
Location :
Scaffold_311:3492- 5206
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_311-fgenesh-gene-0.5Cysteine protease family C01A

Sequence
1714 bases(100 bases per row)
TTGTTCACGCAGCGCCGCGCGCTTCCTCTTCGCGAAGAAGAGCCCCACGCCTGTGAGCACGATCGTGGCGATCGAGACCACCACTGCGATCACGATCCAC
GCCGACGGACTCAGTCCGATGAACACCTTGTCGCCGCCGCCGTCCACCACTGCAGTCGCGACGCCCGCTTTCGCGCCAAGGGGCACGACGGGAAAGATAT
TGAGTCCGCAGTTTGCCTTCTTGTCCGCGACTAGCTTCAGAAAACCCTTGTCGCCCCAGGAGCTGCCGTACGAGTTCTTCAGGATCCAGTAGTCCCCGAC
GGTAGCGTCCGTGCCGTATCCGACGAGCAAGAGAGCGTGATTCACGTTGTCCTTCGAGGCCAGGTCGCCGTTGTTTGGGCAGCTGTAGAATCCGCCCTTG
TAGTCCTTGAACGGGTCCTCCGAGTTGAGCGCCACAGCGATCGGCTGTTCCTGCAGCGCGGTCTTGAGAAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGCATCGCTGCTCGCCGAGCAGTCCTTGCCGACGACCTGCTTCCAGTC
CGAGATGCTCGCCGCGGTCTGGTTCGACGTCCGGATGCACGTCGTCGTGCTGTTACTCGTGGACTTGTCGTTATACGGCATCACGAGCTCCGTCACGAGT
CCGTACTGCAGCTGCGCGGCGTCCATGAACGCGCCGTGGGTCATGCCGCCGTCACAGCCGTTGTTGGTAGATTTCCACTTGATAGTCTCGCTGAGCCACG
AGACGCCGCTCACGCCGCCAGTGGCCCAGCAGTACGTGAACGACTGCTCCGTCTCGCGCGTACTGCACGACAGGAACTGCTGTGGCGCGAGCGCGACCGC
AGCGCTCTGGTTCGCTGCGATAGCGACCGCCGTCTCGATGGCATCCGTGGCGGCAAACGCCCAGCAACTGCCGCAATTCTGCTGACTCTTGACGCTCGAG
CACACGCTGTGCTTGTGTGGGTTCGCTGTGGTGCACCAGTTGAAGTCGCTCGTGGACGAGAACGAGGACGAGCTGCCAGCCATGGGTGACAGTCTCCGCA
GCGGCTCTTTCGCTGCCGCGCGCATCTCCTTGTGCACAAACGCCTCCGGCAAGTGCGTTCGAGCTTTTGTGTCGAACAAATGCCGCCCGTTCACGCCCAT
CTTGTACGTGAACGCATGACCGACCTGCTGCGCATATCGATGGACGTCTGCATCATGCACACACACATCGACACAGAGATATATCGCCAAGTCAGCCACC
ATTACACAGCAGACGCATACTCATACCATCGCCATCATTTTCAGAAATATGGCTCAGAAGAAGCACGCACTCTCGATGTAGTCCATGTGGCGCTGCAGGT
TGCGCAGTGGCATCGCGGCAGCGCGGTCATCCACGTCGTTCTGCGCGAGCAGCAGTCTGCGTAGCGTCTGCGAGTCGATCGCCTGGCCGCCTTCGCCTGT
CCAAAGGCACGGGGCGTCGCGCTCAAGAGGGCAGTTCATCAGCGTGCCCACCGAGTCGCTCTCGGCCGTGGCGGCCATTGCGAACGAGTACGCGAGCAGC
GCGGTCGCTGCTGC