Description :
From Genome Similarity Track
Location :
contig_21:349187- 351945
Transcript NameFunction/comments
g4830.t1hypothetical protein

Sequence
2758 bases(100 bases per row)
GTTCTCAAGCCTGTCAACGACACCTCGGGGACCCCGGAGGTGGTCTGCTTCGGTCCGTTCCCACAGCGCTGCTACGGCTGGTACTCGCGTCGACTGCAGG
ACGTCTTGGACGAGCACCGCCGCCTGGAAGCGACGGGTGACAGTGAACTCAAGGACATTGAGTGCTTCAACCAGCAGTCGAGACTGCGCTGCAACTGAGC
AGGCAAAAGTGACATTTGGATGGACAATCCCCAGAGCTTTATGTTACCGAGCCTGGCGACTGGAGTCGTGTTTGGGCTCCTGTGTTTTGGTAAGCAATAT
GAGACCCCGCTCGCTACCTATTTCAGTCTTCGAGCGAGCTTCAATGTGTATTCTTAGTAGAGCGTCCTTCGCCAGGTGACAACCTTGAAGTCTGCGGTTT
CTCCTTCCCACAGCGACTGCCATCTTGACAGCATGGTATCACAAGCAAGAGAGACTCAGCCAATTCAATCTGCACCTCGACACGCAGTTAGTCGAGCTGT
CTCGAGAGGTCTCAGCACCGATCGGACGCGTGTGACGACAACTGGAGACCTAACGAGTTCAGCGTCGGCGCCGTGTCGTCAGTCCATTCGCAAAAGTGCC
ACCGTTCGGATGCGAAGACGAATTGTACGACAATTTCTCGAGTGGAAGTCCGAGCACATGAAATTGGGGCGGTATTCTATTGAAAAGATGCTTGCGTTCG
AAGAGTACCAACGGGTTGCCAGTCGCACTCGAGTAGCTGCAGTTATCGTGCTGACACCACTACCAGGGTTGCTGATTATTTTATTGATGGCGGCGATACC
TCTGAAGAGCCCTCTGCAGGGGGTAGTAGGAAATACCTCGTTTTTCATCCAGTCGTTTCTTGTACACATCGCGATGACCTTCAGCTTGCTGCTGTTTATC
CGTTGCTCACTCGGTCTATCTCTCGCGCTTTACTCACACCGACAGTCTGCATTCATTTCAGTCCTGGCGTCGGGGCTCAATGAGCTGCTCATGCTTGGAG
TGGCATCGTTGTGGGAGTTTCCTATCCCATTTCGTGGCATCATCGGAGTTCCTCCGTTCTTGCTCCTGCTTGTGGGTTTGCATGGAGTGGTGTTGCCCAC
TCTTATGAAAGAGCTTCGGATAGACAAGTGGAGATATCTCCAGCTCCTTTCAGCACAGGTATCGATCCTTGTGATTTTTCAAGGTGTTGCTGTTCTGTTC
ATGCATTCCCCGGAGTGGGGGCAAGCTGCCATTACAGTAGGAATCCCTCTCCTGCGAATCATACTCAAGCGAATCATTTGGAGACTTTCCAGCTGTCTTG
AAGACATTAGTACAGATGTGGGTGTGTGCGTGATCGAGATTTTCGGGTCGCTCTTTCAGAATGTTTGCCTGCAAAATGCCCGCTCGCTCGGAGTTTGTGC
TTTAATCATCCTTGTCGACTTCACGCAAGCCATCATCGAGACCAGGTTGTACATGGAGCGTAAATTCGTGGTGGACGGACGACAAACGATACGCACTGCG
GTTAAAATTCTGGAAGGAGCACTGCATTTCGGTGTCCTTAATGCAAAAAAGCCTACTCGATTAACTAGGCAGCGTCCAGATAGCACAGTTGTGGGTGTTA
CACGAACAGGCAACTCCGTCAAGCTACCTTCCGTGGACTTATATAGGAAGCCGAAAAGGGTGTCGATAGACCACTCCCAAGCCAAGAACTTGTCGAAAAT
TGCGGTAGTATTGGAAAGGGTGGTTAATGCCGACACTATCGATTTCGGCGAGTTCACATCAGGTACGAACGATACACGAGATGATGGCCATTCAGCTGTC
CGATCTACCACAGCATTTGGGCCAAAGCGCTCGACAATCATTGATGACGTGGAGATCTCACACCGATACCATGCCACGATATTGTCCCAGGCGCTTCAGC
TTGTGTTTGCCTCGGATGTGCTGATTTTTGCTGAGTACGCCGAGTTTACATGCTCCGTTCTCTATGGACTTTATACAGTGCTGATTTATCACTTACCTTA
CGCCAAGTACAATTTCTTCTTCATCGGTCTTTCGCAGCATCAGTTTTATGCTTCAGTTGCCAACTCTTTCGCGTACGCTGTGTTTGAAGGGGCCTCGATG
GCGGCACTTTTTGTGCTCGTGCGATGGAAGTACGGGCTTTCTACATTTCATCAGCTAGCATTCATCTTGGAAAAATATTGGATGACTGTACAAGGCAAAA
TGGTCGGAAGTCTCACACTCATATTCATTCTGAGCACTATTCATCAAGGTACGCTGTTTGCTATACTTCAAGTGGGTAGACTCGTTACTTGACGACTTCG
TACATCAATTTTGCTGCCTGATAGGTATGGATCTATCCCTTACGTTCGATTGGGAGAAGGTTTTGAGCGCCACCGCAGAATAGCCACCTTTCTAGTTTGC
AAGGATCGAAAGCCATTGTGCAAATGAACGAGCAGCTGCAAGTCGCAAAATCGACAAGGAAAAAGAAAGAGATTAGTGTATTTCATTGTTTATGAATTGT
ATTTTGTCTGCTGGTAACGTGCGGTAGATTCTCCACTCGGATCCGACGTCGTCTAAATGGATACATCGGCATCGGTCAGACATCGTCCGAGTCGGATTCG
TTGAGAAAATGCTCATCATACATGTACTTTGGACGCCTATTCTCTTCTACATGTACTTCAAAAGTATTTAGGACGATGGTCTGTCCAGAAGATGCTCGCC
TTCGAAGGATACCAGCAACTTGCAGGCCCTGGTCGAGCGTTCGTAGTCATCACTCGTG