Description :
From Genome Similarity Track
Location :
contig_21:349152- 351909
Transcript NameFunction/comments
g4599.t1hypothetical protein

Sequence
2757 bases(100 bases per row)
CTCAAGCCTGTCAACGACACCTCGGGGACCCCGGAGGTGGTCTGCTTCGGTCCGTTCCCACAGCGCTGCTACGGCTGGTACTCGCGTCGACTGCAGGACG
TCTTGGACGAGCACCGCCGCCTGGAAGCGACGGGTGACAGTGAACTCAAGGACATTGAGTGCTTCAACCAGCAGTCGAGACTGCGCTGCAACTGAGCAGG
CAAAAGTGACATTTGGATGGACAATCCCCAGAGCTTTATGTTACCGAGCCTGGCGACTGGAGTCGTGTTTGGGCTCCTGTGTTTTGGTAAGCAATATGAG
ACCCCGCTCGCTACCTATTTCAGTCTTCGAGCGAGCTTCAATGTGTATTCTTAGTAGAGCGTCCTTCGCCAGGTGACAACCTTGAAGTCTGCGGTTTCTC
CTTCCCACAGCGACTGCCATCTTGACAGCATGGTATCACAAGCAAGAGAGACTCAGCCAATTCAATCTGCACCTCGACACGCAGTTAGTCGAGCTGTCTC
GAGAGGTCTCAGCACCGATCGGACGCGTGTGACGACAACTGGAGACCTAACGAGTTCAGCGTCGGCGCCGTGTCGTCAGTCCATTCGCAAAAGTGCCACC
GTTCGGATGCGAAGACGAATTGTACGACAATTTCTCGAGTGGAAGTCCGAGCACATGAAATTGGGGCGGTATTCTATTGAAAAGATGCTTGCGTTCGAAG
AGTACCAACGGGTTGCCAGTCGCACTCGAGTAGCTGCAGTTATCGTGCTGACACCACTACCAGGGTTGCTGATTATTTTATTGATGGCGGCGATACCTCT
GAAGAGCCCTCTGCAGGGGGTAGTAGGAAATACCTCGTTTTTCATCCAGTCGTTTCTTGTACACATCGCGATGACCTTCAGCTTGCTGCTGTTTATCCGT
TGCTCACTCGGTCTATCTCTCGCGCTTTACTCACACCGACAGTCTGCATTCATTTCAGTCCTGGCGTCGGGGCTCAATGAGCTGCTCATGCTTGGAGTGG
CATCGTTGTGGGAGTTTCCTATCCCATTTCGTGGCATCATCGGAGTTCCTCCGTTCTTGCTCCTGCTTGTGGGTTTGCATGGAGTGGTGTTGCCCACTCT
TATGAAAGAGCTTCGGATAGACAAGTGGAGATATCTCCAGCTCCTTTCAGCACAGGTATCGATCCTTGTGGTTTTTCAAGGTGTTGCTGTTCTGTTCATG
CATTCCCCGGAGTGGGGGCAAGCTGCCATTACAGTAGGAATCCCTCTCCTGCGAATCATACTCAAGCGAATCATTTGGAGACTTTCCAGCTGTCTTGAAG
ACATTAGTACAGATGTGGGTGTGTGCGTGATCGAGATTTTCGGGTCGCTCTTTCAGAATGTTTGCCTGCAAAATGCCCGCTCGCTCGGAGTTTGTGCTTT
AATCATCCTTGTCGACTTCACGCAAGCCATCATCGAGACCAGGTTGTACATGGAGCGTAAATTCGTGGTGGACGGACGACAAACGATACGCACTGCGGTT
AAAATTCTGGAAGGAGCACTGCATTTCGGTGTCCTTAATGCAAAAAAGCCTACTCGATTAACTAGGCAGCGTCCAGATAGCACAGTTGTGGGTGTTACAC
GAACAGGCAACTCCGTCAAGCTACCTTCCGTGGACTTATATAGGAAGCCGAAAAGGGTGTCGATAGACCACTCCCAAGCCAAGAACTTGTCGAAAATTGC
GGTAGTATTGGAAAGGGTGGTTAATGCCGACACTATCGATTTCGGCGAGTTCACATCAGGTACGAACGATACACGAGATGATGGCCATTCAGCTGTCCGA
TCTACCACAGCATTTGGGCCAAAGCGCTCGACAATCATTGATGACGTGGAGATCTCACACCGATACCATGCCACGATATTGTCCCAGGCGCTTCAGCTTG
TGTTTGCCTCGGATGTGCTGATTTTTGCTGAGTACGCCGAGTTTACATGCTCCGTTCTCTATGGACTTTATACAGTGCTGATTTATCACTTACCTTACGC
CAAGTACAATTTCTTCTTCATCGGTCTTTCGCAGCACCAGTTTTATGCTTCAGTTGCCAACTCTTTCGCGTACGCTGTGTTTGAGGGGGCCTCGATGGCG
GCACTTTTTGTGCTCGTGCGATGGAAGTACGGGCTTTCTACATTTCATCAGCTAGCATTCATCTTGGAAAAATATTGGATGACTGTACAAGGCAAAATGG
TGGGAAGTCTCACACTCATATTCATTCTGAGCACTATTCATCAAGGTACGCTGTTTGCTATACTTCAAGTGGGTAGACTCGTTACTTGACGACTTCGTAC
ATCAATTTTGCTGCCTGATAGGTATGGATCTATCCCTTACGTTCGATTGGGAGAAGGTTTTGAGCGCCACCGCAGAATAGCCACCTTTCTAGTTTGCAAG
GATCGAAAGCCATTGTGCAAATGAACGAGCAGCTGCAAGTCGCAAAATCGACAAGGAAAAAGAAAGAGATTAGTGTATTTCATTGTTTATGAATTGTATT
TTGTCTGCTGGTAACGTGCGGCAGATTCTCCACTCGGATCCGACGTCGTCTAAATGGATACATCGGCATCGGTCAGACATCGTCCGAGTCGGATTCGTTG
AGAAAATGCTCATCATACATGTACTTTGGACGCCTATTCTCTTCTACATGTACTTCAAAAGTATTTAGGACGATGGTCTGTCCAGAAGATGCTCGCCTTC
GAAGGATACCAGCAACTTGCAGGCCCTGGTCGAGTGTTCGTAGTCATCACTCGTGAT