Description :
From Genome Similarity Track
Location :
contig_156:34914- 40004
Transcript NameFunction/comments
g11774.t1hypothetical protein
g11775.t1hypothetical protein PHYSODRAFT_289113
g11776.t1ABC transporter-like protein

Sequence
5090 bases(100 bases per row)
GCCGCCCATCGAATGTCCCATGAAGACGTAGCCGTCGGCAAACCTCACGTCACTGGCCACCACACGTCGAATCTCGGCGATTGCCATCGGGATCTGGTCT
TTTATTCCCCCGAGAGAGTCTTCACCTTCGGCGAACGTCAGCGCGACAAAGGCACGTCCTTCAGCCAAGACCTTGGCCTTGATATTGCAGCCGTCCTTGC
TACTGGCAGTCAAGCCATGAAAGAAAAACACTGGAAGGCGCTTCTTTTCATTGCTCGTATTGGCCTGGTTAAGTTGTTGCAGTGGGTCAGCATTAATTTC
GGACGGTCGACATAGATGCAAACAACTTACCGAGGTCATTGCTTTTGCTTCCTGTGGTCGATACCAGCTACTTGATGCAATTACTTGTGTGGATCTGCTT
TCGCACTAGAGGTCGGGGACTCGGCGAAAATGGGTTCGTAATCAGCAGTGAGGTTCGTAAGCATTTTTGTAGAGCTGAAATCTGTTTTCAGGATGCGGGT
CTCTATAATACGTGTGGACAAGAACGCGAGAACAGGGTAAGTCTACACGGCCAAACAAGCATCCACCACCCCGTCAAGTCTGCCATCGGCGTCTTGTTTC
TCAACCAACGAGCCTCACGTCTTTGGTATCTCAAACGACAAAACGAAAGGTGTGTTTCTGAGCTTATGGGAGTCTAAAAGTCAAAAAGCTCCGTGTGGAC
ATCGAAGCTGATGTTCATGTCCTTCGAGAGTGTGAGGCCCGTGGTGACAATGCCATCCACGAGAGGCTTCGGGCCACAAACCAGAACCGCCACTCGTGAG
CTCCCACTGGCCTGGGCCTTTTCGCCCATAGCTCGCAGAATCTTGGCCGTGTCCGGTCGAGAGCCGTAGCGGAGGCAGTTGCTGAGCTGATGGTCCAGTT
GAGCCTCGACGTCCCTCTCACCCCGAGTCAGGTAAAATTCGCTGTAGAACGTGCTCGTCGGGGTATTTAACGTGGTTGGGTCCTGAACCAGAGCTGGGAA
GTAGGGTCCGTCCTGGTGCGCCTCTGTTTCAGTAACCAGAGCCTGAATGAGGTTGCGATCACGTACAGACCATACAAAGTGGACATTCTTGATGTCAGGG
CGGAACCCGTTGTGGCTTTCACTGTGCAACCAGTTGACAATGGAGCGCATGGGAGTAATGCCAATGCCTCCAGAGAACAGGACGAAGTGCGAGTAAACCG
ACGGACTGTGGATGTCAACCGAGACGCTGCCGTACGGTCCATCCAGCAGGATGTCAAAAGGAGACTCTTCTGCTGCGTCCTGAGCTGCACTTGTGACCTT
CTTGGTCCAATCTCCGAGCCCCTTGATGTGAAAAGTGACCATTTCTTCACTTGGCGACGACGAGATCGTGAACGGATGCCACTCGAGCGACGAAATTGTT
GGGATGCATAGAAACGCGTATTGTCCTGCCTCGTACTCGAAAGCCTGGCCGTTGTCTTTGCGAACTCGTGGGAACTGGATGCGCGTGATGTCTCCTGGTA
AGGCGTGGACGGACACTTGGTCGCGGGCGACGATGCCCGTCTGAGCTCCTCTCTTCGACGGGCCTCGAATGTAGTTGCGTGCACGGAAAACGAGTCGGTA
GAGCATGTCGACCAGCCACGGTAAGATGCCGAAGAGAGCGAAGAAGGCGCCGTGAGCCACCGCAGCCACGATCACTACGATGAAGAGGATCCAGTGCACG
CGCACGAAGAGCTCGAAGAAACGACGGCGGATCTTGTTGAGCGAGAACAAGTACATGAAGATCATGGCCACGTACGCGATTGCTCCGGTTCGGACCTTGA
ACTCCATGTCCTCTTCCTCGCCGTCGTCGTCTGCCAGTCGGTGCGAGAAGGCGTGCAGCGCTGTCAGGACGATCGTAGCGTAGGCGAACAACTTGTGGTA
GAACAACGCCCGCTCAAAGGGGATGCCCGTCAGCGTGAGTAGCAGCGAATTGTTACGCACCGCCAGCCCAAACACGAGCATCATGGTGAACGTCGGTGGC
ATGCCGGACATTTTCACGTCGTGTTCGCTGGTGAACACCCCTGATGCAGCCAGAAGGATCAGGAGCAGCGGAAGCGTCAGCACCAGGTCTCCTCGCTTGA
TGTCGAACTTCGCCGTGAGCAGTGGCACGGGAACCGCGTAGATGGTGCGCGACAGTCGCCAGCGCGTCACGACCCACGCGCGGACCCATTTCTGCGTCCG
AGAGAGCTCTTCTGGGACGCTTTGGTGTTTCGGTGAGACTGCGTGGACGTAGGGATTCGACGGCGTGAAGACGTCTCCAACGCGGTTCTCGATAGGGCCG
TAGCTTAGTTCTGGACCACCATGCCGGTGGTGCTGGGTGCGCGTTGGTCATCGCTGAGTCTTCGCCGTGGAGGTGTCTTCGAGAAACTTGGTGCTTTGAA
AAGTGAGAGGCGGGAAGTACCACCGGACTGCAAGGGATAGACTTGAGTGGTGGCGCTACATATGTGCGAGAGTTGGTGGTAGTCTCGCCAGCCCCGATAC
AGAATGCAGGCGCTGGATAATAATCAAACGAGCTCTGGGTTTGATTACCACAAATGTTTCCTGTGGATCGGCGAGTCCGGATACTGTCAAAGGCGTCAGC
GGCCCTGCCCCTAGTGCGATGACCACACCGCGACATATCGACGAGCTGTTGTGATTGATAACCTGCTATTCATTCGAAGTGCCTGTTAGCAACTTGTGAC
GAAAGAATGATGCATGTCTGTTAGAGCCAACACCAAGTGAGGTAATCATCTCCATCCAGGCTATGATAGCCACCGCATTAGATATACCCCGTTACCAATT
CAACCAGTTGAGGCGACTGGAGCTAGAAGCTCGAGCGTCCGAGTGGTTTAACTCACCTCAGTTTCCAATTTCCGGTCCACCGCACACTTCAAGTCCCCAA
GTCCGCTCCCAGTCATGGCGTCACCACGAAACCACTTCATTCGGGTGAACGACACCCCGAAGACCCGCAACGTTGCTTCGGAGCCGCTCAAGTTCACCCT
GCAATGGAGAAATCTGAGCCTCAAAGCCGAAGTGAAGAACCCAGCCACGAAGAAGACAGAGGAGAAAGTGATCCTGAACGATGTCAGTGGATCGGCCCAG
CCGGGCGAGTTGCTGGTGATCATGGGACCTTCGGGGGCTGGCAAGAGCTCTCTTCTTGACTGCATTTCCGGACGCAACGGCGCTGTTGAAGGCGACATCT
TACTCAACGGGCAGCCGTGGACCAAGGCGACAAAGCGCATGGCTTCGTACGTCATGCAGGACGACCTCTTCTACGAGACGTTGACTGTCAAGGAGCATCT
TATCTTCCAGGCGCGACTTCGCATGGGCAAGACGTCTACCGAGCAACAATACATGCATCGAGTGGACGAGGTCATGGAGGAGCTGGGACTCATGAAGTGC
CGTGATACTCTTATCGGTGGCGAGTCGCTGCGTGGGATCTCCGGCGGTGAGCGCAAACGTTTGTCGTTCGCCACAGAAATCCTCACCAACCCGTCGATCC
TGTTCGCTGACGAGCCAACTTCCGGTCTGGACAGCTTCATGGCGGAGACGGTGATCAAGCAGTTGCAGCAGATCGCTCGTGACGGGCGAACGGTTCTCGC
CACGATCCATCAGCCGTCGTCTGAGGTGTTCGCCATCTTTGACCAGCTTTATCTACTGTCGGACGGGTCCCCAGTCTACCAGGGCAAGGCCAGCGAGTCG
GTGGACTACTTTGCGTCGCTCGGGTACCCGTGCCCGCCGCAGATCAACCCCTCCGACTACTTCATGCGCCAACTTGTTGTCATTGACAAGGCGACTGACG
AAGCTGGTGTAGCTCGAGTGGAATCTCTCAAAGGAGAGTGGAGGAAGCACCAGACACTGTCGCGATCTGAATCGGTGTCACTGCAGGAAGGAGGCGGCTC
TCAACTTGAGAGTACGCGCCTGCATCTGCTGGGTCAGATCAGCGTGCTTGCTCAGCGTAACACCCTGCGGTTCCTTCGGGACGGCTTTGCAGTCCGCGTT
CCTTTCATCCAGAACCTTTTCCTCGCCGTGATCGTTGGTTTGATCTACCTGCAGTTGGACTTGGACCAGAAGGGCATCCAAAACTACACTGGTGCCTTCT
TCTTCCTCGTCACCAACCAGATCGTCGTGACTGCAAACCCAGTGTTTGTGTCGGTTCCCATGGAGTTGGCGCTCATTTCCCGAGAGTACAAAGGGGGTCT
CTACCACTTGATGTCGTGGTACCTGTCCAAGAACATCAGCGAGCTCCCCATGCAGATCATCCTGCCGATCGTGTTCTTCGTCCCGATCTACTTCCTCATG
GGAATCGGCCACGGCTTCGAGGTATTCATCTACCTGCAGCTCGTCATGATCTTAATCAACAGCACGGCGATTGGTCTGGCCTACATGGTCTCGTGTCTGT
GCCCGCGTGTCGACATTGCGCCGCTCATCGGTATGGTTCTGATCATGCCGTTCATGCTGTTCGGAGGGCTGCTGATCAATTCGGACGACTGCCCCGACTA
CTTCGTGTGGATTCAGTACATTTCGCCCGTCAAGTACGGGTACGAGGCCATGATGAAGATCTTCTGGAACGCAGTTCCGTCCATCGCGTGCAGCACGGCG
AATTGCACTGCTCGTACGGGTGCAGAGGTACTCGAAAGTTACAGTATGACTTCCCGATCTGCGCTTGGGGACTCTCTTCTGCTGCTTCTCCTTAATATCG
TCTTCCGTGTCATTGCATTCGTCGCGATCTGGTTCCAGCTGCGCCAGAAGAAGTAAGCGTAGCCTAGTACCTACTAGGCTCTACAAAGCTCAATCAATCG
GCATATCTTTCGTTTTAGTGCTGGCAGTTGTGATCGCCGTTGGCACATTGCAGATATATACCAAGCAGCATCTTAATTTTAGTTATGAGAGTACGACTGT
GTCATTCACTCGTCCAACTTTGAGAGAACGTAAATGGATCAAGGACTGGCTCGCGTTCTCGATTCGTTTTGCAGCATCACGTCGACGCTGTAAGAACAAT
GACGTGTTTCCAAGGCATTGGAAAGCGTGGTTGCTTGTAGGAATTGGTATTGTGTTTTGATGGTATTGTCCACAGCCGTCTAAAAGCCGC