Description :
From Genome Similarity Track
Location :
Scaffold_395:3491- 5819
Transcript NameFunction/comments
Phypa_INRA-310PPTG_20261hypothetical protein

Sequence
2328 bases(100 bases per row)
ATGGTCTGCGTGGGTGGACTGGACTAAGCTACCATTGTCATACTTGCTAGGATTTGTGAGTAGTTGTACTGCTGAATAAAGTTAGCAGTTTTAGTGTATT
TGGTTCTAGCTGTCTGGCTTTGACCATGTAGTCTCGCCAGTCACGGGGTTGTAGTAGTATGTAGTACCGTTGCTGTCCTGCATCTCTTGCCATTGACTTG
CTGCTATTGACGGTTGGCTCCAGCTTGTCTCTCCTGTTTCCTGGTTGTAGTAGTACATGGCGCCACTGCTTTCGTCTCGGTACTCAATCCAAGTGCTTGG
AGTTAGATCAGAGGTAGCCTGAATAATGCCATTGCTCGAGCTTGCAGATAACCTCTCTTCTTCCTCTCTTGCCTTTCGTTCAGTCACTACTTGGCTCTGT
TCGCGGATAAAAATCTGCTGGACGATCGCATCAGCTTTTACCCAGTCCTTCTCGGTGATGGCTGCTTCCAGCCAGCTCATATGCTGGTCTCGTGATGAAT
ATGGCACTGGAGACTCACGAAGTTGCTTCACTTGCGTGAACAAAGCCAAGGATATTTGATCTTCCGTGTCGGAAGTGTCGCGAGCACTGCGAGGTGAAAG
AGACCACCTCGATTCTCCTGTTACTTCGTTGTAGTAGTAGGTGTTTTGAGTCTCTCGATCAACAAGTTCGACCCATTTTTTGCCAAGAATGCGTGACTTT
GACGATCGAGTTGTGAGAGAGCTGCTGCCATCGTCATTGACCTTTTCATGAGCCATCTCGAACCATTTACGAGCCGAAGAACTGGCACTGCGTCCGCTGG
CGAACGCTTCGTAGCTGACGTCAAAGTCTTCAGGTTTTTCCCATCGGTATTCGTTAGTAAGTATGTTGTAATAGTAGGTCATGCCGTTGTCTGGATCGGT
GTGCTCAGTCCAAATGGGTCGCGACTCAGATCTCGAACTCGTGACAAGTTTTCCGTTAGCGTCATATTCGTACCCATATCGATACTGCCAATGAAGCGAG
CGAGAGGTTCCGATACTGCGAGCAGAGCGCCGTGAGTTCATTGTAGTGTCGCCGAGTGATGCATGGACACTTCGAGGTGACAGCGATGCTTTGATCACCC
CTGTCGGTGGATGATAAAAGATAATGTACTCGGTCAGCGCATCGACTCGTCTTTCCCACTGTCCTAACACAGGTAAACGGATTTGTGTACTTGCAATCAA
ACCTTCGGGATCTTGAAGCTGCTCTTCGAGCCATTCCTTCCGCTTGCGAGAGGTCTGACTGTCGGTAAAGTACGCGTTATCGATAGCATCGGGTTTATCC
CATTGGTATTCCTCGGTTTGGCTGTTGAAGTAGTACGGAGCTTGAATCATGTCATCAAAAGCTTCGTACCAATTACATGACGAGGAGTGCTGTCTGTCCC
CACTGGTACTTTGTCGATCTGAAAAACTGCGGTGACTATGTGGAGGTTGATCAACATTATTGGTTGCAGGTGCAGGTACTTCAATAGATTCCGTCAAGGG
CACTGCAAATTGATCTCCGAAAATGTCCATTGCTAGTGGTCGATGCCATCGTGTAGCACCTGTCAGCGCGTTGTAGTAATAGGGTCGACCATTATCGGGC
GACACCATTGGAATCCAGCAATTTCCTCCCTCTCGAACTGCTGCTCTTACGCGAAAACCGCGGAATATCTTCTGAATAGTAATTGCCGCACGGCGTTCGT
GTCGAACTTTATCTTGCAGTCTCTTCACTCGATTTTCGCGAGTTTTCTTGATGACTCCCTCGGTTAAAGGTTCAAGCTCTCGCCTAACAGCCCGTAACTG
TTTCTGAGCGTCGTTCAGACTTGTCGTCAGTGTCTCGTACGCCCGATCATCAAGTGCGATCTCGGTTCGCTTTGCTCGAAGCTGATCCGCAAGCTGAACT
TGAAGGTATTGCGTTAGATAACGTTGTGGTGTTCCGGTGATACGGCTCGAATCGTGATATTTTGTCTTGATCTGAAGCGTTTTCTCGAGTTCTAGTGTCA
ACGAGCGCTCTTCAGCTCCATCGACAGTGATTTTGCGTTGAAGCTGCTCAACTTTATCATTCAAATCAGACACCAGCGACTGGAAACGTGTTTCTTTCGC
GAATAATGGTTTTGCTTGATGACGGAAACGTTGTAGCTCTCTCCGAAGCTCTGCCTCACCTCGTCCACGATGGCCTCGTATCAAGCGTTGAATATCTGTA
GCAGCTTTCACTCGTTTCACTTGTGACGCTAAAGCCAGCTTCATTGCCTTCATGAATCCTCGGGAGGCGTGTATACGATAAGCAGCCTGGATCGAGTGAG
CAGCCTCGTTCTCACGAGCACGCAACTT