Description :
From Genome Similarity Track
Location :
Scaffold_30:3491- 22764
Transcript NameFunction/comments
Physo_134091hypothetical protein
Physo_134092pol protein
Physo_134093hypothetical protein
Physo_134094Quinone oxidoreductase
Physo_134095hypothetical protein
Physo_134096hypothetical protein

Sequence
19273 bases(100 bases per row)
GGTGATTATGTTCGAGGTGCTCCATCAACAAAACGATGTCGCAGTCCGATTACGTTGTCACAACTTGGGGTCCAGCGGTCGAAATTGTCAACATTTCACA
TTTCATTTCGCCTCCAAGCACACAAACATATCAAGCCCAACCAAGACCACTCTAATGGCGTTTCCGAAGACCTTCCGTGTGTACCAGTACGAGAACTACG
GCTCGCTCGAGAAAGAGCTCAAGATCCACGACAACATTCCTCAGAAACCTCTCGGCCCCGAGAAGTGCGCATCAAGGTACGCAGCGCCGCGGTGAATCCC
ATCGACTACATGCTGCTGGAGTCTGAGGGCCAGGCGTTCATAGGCAAGGCTCCGTCGGCTGAAAACCCCTTCGACATCGGGTTTGACGGCTCTGGTGAAG
TGGTGGAAGTCGGCAGTGATGCAAAGCGGTTGACGGTGGGAGATGCGGTGTATCTGATGACACCGTTCACCTCTTTTGGGACCCTTGCCGAGTTTCTGGT
CGTTGACGAAGAGTTTGCTGCGGCGAAGCCCAAGAATTTGGATTTCAATGAAGCTGCCGCAGTGCCTTCAGTGGCGCTAACAGCTTATGCCGGTATGGTG
CGGCACGCGAAGCTGCAGAAGGGTGAGACCGTTCTCATTGTCGGCGGTAGCAGCTCCGTCGGTATGTTTGCCGTGCAGTTTGCCCACGCTAAAGGTGTTC
GGGTCATCGCGACGACGCGTTCACGTAACGTTGAGCTCATCAAGTTTCTCGGCGCTGATCAAGTCGTCGACTACACCAAGGAGAAGTGGGTGGACGTGTT
GCCGCCGCACTCTGTTGATGCGGTGTACGACTGCGGGGTGGAGCCCTCGGCCTGGAACGACGGTGCGCAGTTGGTGCTCAAGAAGAACACGGGACGTTTC
ATCACGATCCTGCCAATGACGCAGCCTGTTAAGGACTCGGAGTTCGGGGCACAGCTCGTAGGCGAAGTTCACAACACCGATCCTTCTGCCGAGAAACTCG
ACGTAATTACCAAGTACATCGAGAGCGGCACAGTCAAGCCCGTGATTGATACTGTGTACCCGTTCGACAAGGCGCTGGATGCCTACGCGAAGCTGAAGAC
ACGCCACACACAGGGAAAACTGGTGGTGCAGGTGCAGCCTTGAGGCGAAAGGACGATGACAGCACGTCGTAGCGCTCGCAAGTGAAAGAAAGTTTTTAAG
TTCTCGACCGCATGAAAAGCAAACCTTGTAGTCTTATGCTGATACATAAAAGAGTAAAAGCTTAGCTACAAGTCCTCCGAGTCTCGCTCGTTTCACGGGT
GCACCTCAACCACCAGCTTTCCCTGTGCGTGGCCCGTTTTCAACTTCTCAAAGGCGTCCAGCGCTTTATCGAATGGGTAGACTGTGTCGATCACGGGCGG
GCGCGGTTTTTTTTCATTCTTTCAGCGGCTACTTTCCATTTATGGTCAAAAAGTCTGATTTTCATTTATTATTGGCTAGTTTTCATTTCGATGGTGTCAG
GGCCTGGTCGGGGAACGCTCGTCTCGGCTTTCGATCGTCTTAGACGATGTGGCGACATTTTTTCTTATTTTTGATTGGCCAGTTATTAGCTCGATCGGCT
CCGGACTGACCAATCTGAGACGACTAAATCACCAGTCTCACTTTGGAGACGAGCGTCTTCACAGCGTTTGGATGGTGCAGAGCGAAAGCATCGTTGCTGC
AGTTGCTGCGGCCACGGGGGCTCCCGCGACGGCGGTCCACACCGCTGTGTGGGCAATTTCGAACCCAAAGCAGAACATCCTTACCCTGACACCGCTAGAG
TTTAAGGCTATGCTTTACGACGCGGTCTACGACGAGTGGTTTCGACAGAATCTCAGGTGTAGCCAAGCTACGTTTCTACCGCTTTGTGGTGTTCTGCGTC
AGGAGCTGAATGATTTTGAGCTAGATCGATTTATGAAGGAGCACTCTTTTGAGGAGAAGGTTGCTTGTTTTCTTTTTTTCTCGGCTCGCAGGGTGGCTAT
AGAGAAACTACGGCTGCGTTTGCAATTTCGAAGTCCTGGGCTATCGACGTGATTGGTATATTTCTCAAGGCTTTACGCCGGTCGCTGCGCAAGTTCGTTC
ATTTTCCGCGGCTTGCTCATGAATGGACCCGAGTTCAAGTGTAGTGGGCCTACCTTGGCTCACTACTACGGCTTACACGTATGCGCACGTGTATGAGGAA
GCGTAGGTTTCTTTTACTTGAGTTAAGTATACTCGAGATCCACGAGTATACTTTAAACAAGATAAAGACTCCAAGTAGCGGGTTTTGGGAAAAGATGAGA
ACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCTAAATGTAATATTCTAAGATAGGAATCTGCCAACGGCTGGTTGGCAGGATTCTGCTAACATGCAAA
TCACTCATTGGCTAAAAGATGCTGCTTTCAGCCAGAGGAATCCTAACTGTGTATAGACCACCCGTCGTGGTGGTCGTAAATGTATGTAGACATTGGTGTA
CCTTACACCAAGGTCGAGGAAGTGTTCAAACCTCTAACAGACATCGCATCTGTTAGAGTAACAAGTGACTGTAGCCACTTTTGCGTGTAACCCCGTTACA
CCATCCCCCCGTCAAGGTTAGACGTGCCGGTCCCGGCATGTCAACCACCATTGACCGCTTAGTCAATGCGTGACGTTGAAGAGAGCGCGCTCGTTATGGA
ACGAGCGCGTCGAAGTTGAAGACCGCTGGCGCAGCAGCGGAGAACCTCCCTGCTGCTGAGTAGCATGCGCGGCAACGTGCGAAGCGCATCGCTGCCGCGG
GGCAGGACCCACAGCCTGCCCTTGAAGTGCCTTCGGGTGCTGTTGTTAACAACAGTGCTCGTATTACTTTCCAGCGTGTAGCGCATGGTGGGCTTCGTAC
GCCCTCACCATGTCCGGGACGTCTTCGAGCAAGACGTTCCGCGGCTCCCATGCATCTTGGTTGGGAGGGAATCCTCTCCAACGGATACGAAAACGAACCG
GTTGCCTGTTCGTTCTCGGGATACTGTGACCAACAATCCGCTCAACTATCCATCGAGTTGAGCCGTGCGCGTCACGAATTGGCGGCGGTGGTGGAGGAAA
CACGCCTCGTGTGTGGTCAACTTGGTGTTGACCCTGATCTCGCGTCTCCCCGCGACCGAGTTTCGGTCGTGGAGTAGTTCCAGAGCGCTGGGTTCGGCGC
TCTGAAGTATCCTCAGGTTGCGGCGGCCTCCCAGGCCGTCTCGATTGTTCCGGCCGAGCTGGACCATTAGCTCGACCCGCTGCTCCAGCGCGACTTCGCG
CTGGTGAGGATGACGGCTTCCGCCGAGTCTTCTGCTTCGATTCAGCCGAGCTAGGTAGCTCGTACTGCAGGTATGGCTTCAGCCGTCCGACGTAGAACGT
CGGATGGAGGCGCATACTAGACGGTATGTCCAGTGTGTAGGCGTTGCCGTGCCGTGCCAGCACAGTGAACGGCCCGATGAAGCGCGGAGCGAGCTTGCTC
GCCCCGAAGTCGGAAACTGCATGTTTAGGCAGGTTTTGAGTAGCTAACAAAACCAATGAACCCTTCTTGAATTCATTTGTGTTGCTCCTGCCAACGTTGT
CTGCGTTCAGCTTCTGTCGATCAACAGAAGCTGCAATAATAGCGTCTTGGACAAACCGAATGACGGCTTGTCTGTGCTGCACGAAGTTGATTGCGTCCGA
ACTGAACTCGTTCAGCTCGTTCCAGCAGTAGGCCCGGCCTCTGCGTTCGTCTTCGCGAGTGCCTGTGTCCTGTATAGACCCGTTCTTCTTCTTGCTCTTG
TCGGTGTCTGTGCCCTGCACAGACGCGTTCTTCGTGCGCTTGTCGGCGTCTATGCCCTGCACAGACGCGCGGTTCTTGGCTTTACTTCGTGTCGTTGCGG
CTGCTGCGTTGCAGTCGTAGATCCTCCCCCACTTAAGGAAGGAGCCACCATCCCGAGTAGACTCGGGAGGCGTGGGTGCCTGATGGCATTCACGTAGAAG
GGTGTATGCCCGGTCGAGGCATGCACCGAGTTATTGATGGCGAACTCCGCCATCGGCAGGCACTCGCTCCAGTGTTGGAGCGAGTGAGCGTAGCTCTTAA
GCACGTCTACGAGCACGCGGTTCACGCGCTCGGTCTGCCCGTCCGTCTGCGGATGGTCCGCAGTCGACATCGAAAGTTGACTCCCAAGAAGTGTAAACAC
TTCTAGCCAAAGGTGCGCAGTGAAGCGCGGGTCTCGATCCGACACAATGTCGATCGGCATGCCATGGTGTTTAAACACCATGTCGACGAACAGACGTGCA
GTCTGCTTTGCAGTCACTTCAGCGGGTACTGCAGCAAGATGTACCATCTTGCTGAAGCGGTCAACAAAGACCACAATGCCCGTGTTCCCCTGGCTGTCCG
GGGGAAGACCGAACACGAAGTCCAAAGACATGGACTGCCAGCACTCCGACGGAGTCAGCAGTGACTGCAAGGGAGCCTGCGCGAAAGGCGCAGGCTTCAC
ACGTTGACAAACCTCGCAAGCACGGACGTACTTGCGCACCCATTTATACTGGTTGGCCCAGTAGAAGTCTCGCGTGAGAAGAGGTATGTCTTCTCACGGC
CCGGATGTCCCGCAGTCGGTGCATCGTGATACTCATACATGATCCTGAGTCGCAGGTCATGGTCATTGGGCACGACAACGCGGTCCGCGTTGTCGTCGAC
TGCACTGTAGAGTAATAACCCATCGTGCACGCGATAACGGTGTGCACGAGCACGAAGATGCTTCGGCAGCTTCTGACGAGCTTTGTCAGAAGGCGCTGAG
CCATTGGCCAGCAAGAGCTTCGCGTCCGCGTCGTGTGCGCACGCGGCCTTCACGTCGTCCAACAGTGACGACGTTGGGGTGCTCGATCGCATGGCGTCAA
TGGCATTGACGTCGGCTTCAGTCGTGGCGTGGTCAGGTCGACGCGAGAGCGCGTCGGCCTCTTCCGGGTTTGTACTCAACCCGGAAGTTATACTCTGCGA
AGAATGAGAGCCATCTCGCCATCCGTTGCGAGATGTGCGGCGACTTCACAGCCGTCCGCAGCGACGCGTGGTCTGTATAGACCACGAACGGTTTGCTTCC
GAGTAGATACACTCGGAACTTCGCAAGTGCATACTTCATGGCAAGGAGCTCTTTGTCATGAACCGGGTAGTTGCGCTCAGCTGGCTTCAGCTGACGCGAT
TGGTAGTAGACGACACGGTCACGGCCCTCGTGATCGTCCTGCATCAACGCACATCCGATTGCGAAGTCGGATGCGTCGCACACAACGTGGAACGGGCGAT
CTTGGTCGGCCACCGCCAAGATCGGTGCTTCCGTCAAGCTCGCCCCGAAGATGCACTTCTTCAGGTTCGCATAGAGCTTGTGCTTGCGCATGAGCGCAAG
CAGCTTCCGGAGATGCACCTTGTGCATCTCAACATCGCTCATCCCGTCCGCAGCCCGGCTGTGGACGAACATATCGCCGAAGTAGCTCGGTGCGAAGTCG
CGCACCGAGCGCAACAAGTGCGTCACACACCTGTTGAAGGTCGCAGGGGCGTTCTTCAGACCCTGCGGTATCCCTAGCCACTCCCAGAGCATGCCGCTCG
GCGTGCTCACAGCCGTGAGAGGGATATCGCTCTCACACATGAGGATCTGATAGAACCCATCGCGCAGGTCAAGAGCACTGTAGATAGTGCTCCTGGCCAT
CGAATCGATGATAACATCTTTTCGCGGTATCGGTGTCTGCGCCGGTATCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCAGCCGCCCTGT
GGCTTCTTGACACAGAACGTCGGAGCACTGTGCGGGGATTTCGATTCCTGCACTTGTCCAGCTTTGCGACGACTCTCAAAGAAGTCGTCGATCGGTTTGA
CCTGCTCTCGCGGCAGTGGCCACTGCCGCGTGACACAGTACTTCGTGCCCGGCACGAGATCAATCTCGTGCTGGATGCCCTTGTCCTGCGGAAGTTCCGC
AGGGATCTCTTCCGGAAGTACGTCCGCTTACTCCCGTAAGATCTCGTAGTAGGGACTCGTTTTCAACGAGTTCCAGCTCTGCTCCTCAAAGCGCTCCTTC
TTAGTCTTCGCACTGAGAGTGTCCTCACTCTCAGTGGTGGTCTCCATGAAGAACTGCCTCAGTTCTTCATTCTCGCTCTTCGTTCTCTCGGCGTCCGAGA
GAATGCATATTTGCTCGATGCGTCCATCGTGCAAGTCACGCGCGAAGCGCTTCCAGCTCATGACTGGAAGCGAAGTCAACTCCGACGCTTGCGTCGGAGG
GTTAGCGAGAGTCATCTCCCTGTACCGGAACCACGCGTCAAGACGTTCAACGTCTCGACGTCCGGCTTTTCAGCCTCCGTCTGTCCGGCAGACATTCCTT
GTAGCGCCTCGGCCTCAGGCCGAGACTTGCGCAGCGACCTTCGCATGCGCCGTCTTCTTGTTTTGCGGAGCCCGGCTCCGCTTGGATCTTGACCTCGTCC
AGGCCCAGCCGCGGACGGGTGTTCTTCTTCAGTACTTCCGGCGGGTTTATCCCGCGGGCGAGCGACTTCAAGCCCGGCTTGGTCGCCCGGCGCTTCGTCG
TGCAGCCCGGCTGCACGACAGCATGCACGTTTTTCCGGTGCGGGACGTTTGCAACCGTCCGCACCGCTTGCAGCGTCGGCTCCCGGAGCCGACACGCCAT
CTTCACCTCGACGCCTGTTATTGGCGGAGACCCCCATTACATAGGGTGCGTCGGCTCCCCGAGCCGACGAATCAAATTCACCCAAGCCATCGACTCCCGG
AGTCGACGGCGCCTCGTCACCTTGGCTCTTATTATTGGCCAGACCTGATCCAATCAGATTGGCGTCAGCGTCCACGGCTGAGGCGTGTGAATCGCCTGCG
TCATCCGTGCCCCTTGAGGTCGGAGACTCTTCCTAATTCGCGAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACGCGCCAGAATCTACCAAAGCACGGAGAGAGCCGCTTGCTCTCATCGA
GTTCACATTCAGGATGACAAGGTCAGGCTTGTCATCTTGGTTCTTGCAGTGAGAATGAACCTCACTGGGGGCTGCAGTCCTCAGTGTCGCGTGTCCAAGT
TCGACACGCGGAACTGCATTACCAGTAGGGCGCCCCGCGCCTACTGGCGTCCAGCGTTTTTTGTTTGGTTGCGACGGTGCCCGGCACCGCCGCGATAGCC
ACCCTGCTGGTGCACGGGGGCCGTGCACTCCCGAGCAAAGTGACCGATTCTACCGCATCGGTAGCATCGCACATGGTTTCCTTGCGACTGCTGGGGTCCA
GCAGTTGCAGCGCTCGAGAGGTCCATGGGTTCTGGGCCTCCCGTCCTCACTATCGGGCGAGGCTGTGGCCTCGGCGCATGTGCATGCAGCTTAGCCTGCC
GCAGGCTAAACTCCTCCTGCATTGCAAGAGTGATTGTAGCTTCGAGAGTACTCGGGTACTCACGGAATAAATAGGTCTTCACATGCCCATCTCTCAGTCC
CTTCATGAACGTGACGACCTTGGTCGCCTCGTCGATCGGATTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTCTGAGCGTAAGCATGGACATCATGC
TTGCCCTGCTGCAGGTCGAGGAACTCCGCCCTCGACCGGAACTCATTTTGCGGGGGCTCAAACGCTTGTCTGAGCTCCTCCTTGAAACCCTCATACGTGC
TGAAGCACGTAGGATCAAAGAGTACGCCCAACTTCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCGACCTTCGACAACGGGTCGACGATGCGTCGA
GCCGCAATGGCAGTGTCAAGTTCGACAAGCCAACGGAGGAGAGGCTCGCCCTCTCTTCCAACGTAATTGCTCACGCTGAGCTTCAGCGATTGCGCGCGCG
GTGTCGTCCCCGACGACACCGTGGTAGACGAAGCAGCACCTCGCTGCTCCTTCATGATGAATCCCAGAGCAACACCGTGTTGCTCCGTCGGCGATAGTGT
GCGCAGCATTGCAGCTACAGCCGCTTCTCCAATGACTGTTGACAGTCGTTGGAGTGCCTCCCACTCTGGATCCGACAGGTGGAGGCAGTCAGCGCGTGCA
ACATGTATTGCAGGCGAAGTGGAGCTTTCCATGGGCACCTCCGCGCTCATGAAAAGGTTCTCGGCTCATCGTTCGTACAGCTCCGTACGAACGTTCAGGT
AGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAGTGGGCCTACCTTGGCTCACTACTACGGCTTACACGTATGCGCACGTGTATGAGGAAGCG
TAGGTTTCTTTTACTTGAGTTAAGTATACTCGAGATCCACGAGTATACTTTAAACAAGATAAAGACTCCAAGTAGCGGGTTTTGGGAAAAGATGAGAACT
GCTATTTTTGTTTTATGTTTCTGACTTCCTCTAAATGTAATATTCTAAGATAGGAATCTGCCAACGGCTGGTTGGCAGGATTCTGCTAACATGCAAATCA
CTCATTGGCTAAAAGATGCTGCTTTCAGCCAGAGGAATCCTAACTGTGTATAGACCACCCGTCGTGGTGGTCGTAAATGTATGTAGACATTGGTGTACCT
TACACCAAGGTCGAGGAAGTGTTCAAACCTCTAACAGACATCGCATCTGTTAGAGTAACAAGTGATTGTAGTCACTTGTGCGTGTAACCCCGTTACATCA
AGGTAAATTCCAAGCGAAAGGTGGAATTCCAGGAGTGGTGGGCGCGATAGACGGCTCTCTAGTGGAGATTAACAGGCCCGAGGACTTTGAGGGATACTAT
TGTCGAAAGATGTTCCCAGCGCTAAATGTGCAGGCTGTTGTTGACGACAAAATGCGCTTTACTAGCGTGGAGATTCGGCCGGGCTCGTGGTCTGACCAAA
AAACATGGCGTGCGTCTACTTTAGGCTCCAACTTCAAAGACGTTTTGCTAGCGGGGACCCACTTTTAGGAGATGCAGGATATGCTATTAGTCCGGCTATC
ATGGCGCCGTTCATGGAAAACGATGGAGCCGGTTTGACACGCAAGCAGCTACGTTACAATTATCTGCATTCCCGAACTAGGATGACAGTCGAGTGTGCTT
TTGGACTCTGGAAAGGTCGCTTCAGAATTGTTAACTGCTGCATTAACACCAAATGCGTCGAGAAGGCTGTGGATATTGTGGCTGCAACGATGGTTCTCCA
CAATATTTTGTTGGGTTTGAAGGATGACACTTCTTTCGAAGATGAAGATGACGCGCGGGTGAACTTCGATGAAGAGGAAGATTTTGTTCTAACTGGAAAC
AACTCTGAGATGACTGCAAGCTTTCTAAGAGATGTTGGTTCGAGAAACGTGAGTCCATTTTGGCCTTTACCGAAGCTTTTGAGCTAGTCTAGAAAACGTG
TGTAGCTAGATTTTAATGGTCGCGGCGAATCAAATCCAGTAGCTCTCGAATCGTTTCATTCTGCACTCGAAGTCGCTCGCTCTGAGCTTGCATTTCCGAC
AAGAGTTGCTCGGTTTGGGCATGAGCCCGCTCACTTTGCTCGCGGAACAGCTCGGTCTGTTGCTGCACAGCAGCTGCAATGTCTTCGGCACTCCCATTTC
GGACTGTAGCAAGTCCTTGGCCCAAAGCTTCTAGCCCTTCGCTAAACCCTTTAGCAACCGCACTCAAACCCGCCTCCACACACTCCCCCTGGGTGCGCTT
CTGTCGCTTATTAGACGACCCCGTGGAGCCAGACATGGTGCGGGGCGTTGGAGATTGAGGAGGGGGAGGCGAGGCAGGCGTGGCGAAGGCAGCGACGTCG
GCGCTCGCAGCGTCACCAGCAGCAGCAATTGTGTCCGGGTCCTCCGTGCTAAGATGCGGTCGGTTGTTCATCCCCGTCGCATCACCCCAGTAGTCTTTCA
TGATGGAGTAGTGATTTGGGCGCCACACGGGTCCGTCGTTGCCAGTTCGACCTTCTGCTTCCCGCACAGACGCCCACTTTTGCTTCATCTTCTTCATCTT
TAAAAACTATTCACCGCACATCATGATTAATAACTTAGTAGTGGCTCATTCCGATAGATATTTTCACATTGTAGATATTTACCTTAGATTGACACTGCTG
GTCAGTGAACACTTTGCTCTGGTTAACAGAGAGTGTTGATGATAAGACGGCCCACGCATATTTGATGCGCTTGGTGTCCTTCGTGTTCTTGAAGTTGTCA
GCTAACTCTGCGTAACGGAGGCGAAAGACCTCGCTCACATCATCATCGCTCCATGATGCAGCTGGCCTGGTCGAAGCTCCTCGTCCTCCACGACCACCGC
GACCTGCCCCGCGACCACCACGGCCTCCACCATGCGGGGGTGCCCTCTCGACGCCGCTCCCGTTGGTGTCCGTGCCGCTTACGCTTCTCCCAGCAGCGTC
TTCAGCTTCAGCGCCGCCCACAGGTGGAGCAGTAAGGGTGCCTTCCATGGCTGCGAGTTCTCGAGTGTGATGGTGCTGAGTCGAGCAGCTTGACACACCA
AAACTAAGACGGTCTCCAGCCAACCGACCACATCGGCTCAGTTCACCTTAGGGGTAGGCTTACCGGAGACGAGCGAGACTGAGACGATCATTCCCCGACC
AGGCTCTTATTGCATTCACAAGGGTTATATTGCATTTATTGAAAAATGAAATGTCCGGGTTACTCGGTCCCTAGTTCGTAGCACCCGAAGTGCTCACTAC
GTCTAGCCTTATGTCGTCCACTTGCTATTCTGCTGAAGCTTCACGCTACCGCTGTTGTGTCGAAGATATGCATTAGTTGGGAACAATGTTGTGCCCCATT
TGGAAAGAGAAATTGATCGTCCTGGCAAGAGCTTCAACTTCCAGGACAGTCACCTCATCTTGATCCTCGTACGCGATCTCCCAGAACCGCTTTCCACCAC
GACTGAAGGGGGGGTTAATTTTGCCAATATAGGTCCGCTGGGACTCCTCGCCATCCGCCTCGGTCACTGTCTTTTCGCTTAGCACGCTCCAGTTGATAAC
ACTTGCTGGCTTGTCCACAAGTCGTTTCATCAGGGCATCGACGGAGTATTGGGATGTTCTCACACCATCTCACTGGAGGCATTTGCTTTTCTTGCGCGGT
CTACCGGGAGGCCTGCGAGTTGGGAGCCCACGAAGCATCACCGTCAAATCAAGATTGTCAACGAGGTGAAGGCATGCTAGTACATGAGCACACAGCCACC
TCGTCTGGTAGAAATCTTTGCAGTCACACTTGAATTTTTTTCTGATGGTGTTGATCTCCTCCAGGGACCACAACGGAGAGTTCCAGTCGTGCTCATACGG
AAGTCGATCCAACACCGCCACCTTGTGCAGTGAGAGGTATCGAAACTGGACATTCTCCACAATTTCATCATCCTTGAGGGATCCGCTGACCGATCTCTCA
TAGGTCTTTGTTCGGCTCGCGTTCACCTTCAATCCATGCACATTGTCGTCCCGGACGATGTAGTATCTCTGGTTGAAGTAATACGCCTGGATGTTGCGGA
TTGCTCTGCGCGACTTGCGTTTGTGAGTCGGGATGTAACGGGGTTACACGCAAAAGTGGCTACAGTCACTTGTTACTCTAACAGATGCGATGTCTGTTAG
AGGTTTGAACACTTCCTCGACCTTGGTGTAAGGTACACCAATGTCTACATACATTTAAGACCACCACGACGGGTGGTCTATACACAGTTAGGATTCCTAT
TGGCTGAAAGCAGTATCTTTTAGCCAATGAGTGACTTGCATGTTAGCAGAATCCTGCCAACCAGCCGTTGGCAGGTTCCTAGTTTAGAATATTACATTTA
GAGGAAGTCAGAAACATAAAACAAAAATAGCAGTTCTCATTTTGACCCAAAAACATTATTTGGATCATTTATTTAGATTAATCTATACTCGGAGGTCCGA
GTATAGATTAACTCTAGTCTAAACTAAGCTACGCTTCCTCGTACACGTGCGCACACGTGTAAGCTAAAGTAGTGAGCCAAAGTAGGCCCATTACACGGGA
AGTGGTTGTCGTCGTTGCAGAGGAGTACACCAGCTTCTAGAACCTCTGCGGAAACTGGCCCAGCGGCAAAGTGCTGGATAGGCTCCGACCCAATTTCCAT
CGCGCACTCGACCAGGATTGTCGTTAGAGTCAACGCAAGCACATGCCCTGTTGAAGCCCGCAGCTGATTCACTGCAGTAGTCTTGATGCTGTGGTGGTGC
GATTCAATCGGATTCTGGTTCGGAACAATACCTGGAACGTCGCTGGCCGTATAGAACCACAGGTCCCACGGCTCTGTAAGCTATTCCGTGTCCAGCCACG
CCGCATACGCGCCTTCACCAAGGTCGTCCAAATTCTAAGTAAGGGGTGCGGAAATCGCCTCGAATTGCTGCTTCGAGCGCGATTGACTCAAATAATCGTG
CTGGGTCTTGTTGATGTCGTTGTAGCGGTCGCGCTCTGCAAGCAACCCTTTCTTCTTCCGAGCATTCCGGTCGAGATGGGGCCAGCAGTCGAGAAGCTTG
ATCTCTGACCAGACTGTCTGGAAAGCGTTCGCAATTGAAGTGGAGCGGTCCAATGAGCCAAACCGTAGATCCAGTGCCACGCCGAAAAATTCTTGGCACC
GTTGCTTCCATACGGAAAACAGCTTCGTATACGCAAAGGCGGTCTCCGTCCTGACGAACATAAATGCCATCGGGTAAATCTTCTGTTGATACGCATGCGA
AGCGGTGTAACGAAGTCCGAATGTGCCAAAAGACACAAGCGGCCAACCACCGAAGTGAAGCTTGTATGTTCCATCTGTGACCCCGAACATCTCGCCATTT
TGACTTGCCACTGTTCTGGGAGCTGTTCGAAAAAGCCTTCGCGAAGTGAAGATGATTCCGACCGAGGTGTCACCACTGTCGATTGTGTCGGTGAAGCAGT
CCAGCACTATGAGCTCATTTTGAAACTCAAAGGGTTGGCGAGCGATGCGCCGAGCGTCCCGCTCGCGATTGTAGCGCATATGACCGAAAAATGCTGCTGG
GGTTGTGCAGAGTCTTGGCGTCGCCCAAACCATGACATCAGCGTAGGTGGTAATGTCCAAATCCCCCCGTCTTCGCAGTAGTTGTGCTCTGTTTTTGACT
TGGGAAGCTGATGGCAGCAAGGCGAGAACTTCTTCGGAGTGATCGTACTTCATGCGTAGGGTGTTCAAACACTTTTTGGGACCTTGGCCTCCCAGCAGCA
AACCGTCGATCTCCGGAAGTAATGGCTTGTAAATCCCCGTCCGCTGCGTCTCAATCGGTGCCACAACTGCCGTATGTATACCACTACGCGACAACGGAAA
CTTGCCGCCGGGATCCAGAGTGATGCTTCACACCTAGGTGCAAAATATGTGATAGCGGCTTCTGTACTTAAATCACCTAGATAAAATAGATATGATAGCG
ACTTCTATACTTAAACCTGCCACGAACCTTGTCCGAACCTTTAAAAAAAAGGCCAGAAATGCTGTAAATGACGCTATGTTAAAGTTCCAGAAACTTGCTT
CGATCCTGCCCTTCTAATTGTTTCGGTACGGCACCGAACAGTAACCCTACAAGCCCTGAACCGAAAAATTTATGCAATGCATGTAACAGCCATTTCGAAT
GTACAGAATGAAATAAATCCATCAGAAATGCAATGTAGCTGTCGAGAATGCAATTTATCCCCACTAAATGGAAAGTAGCCGGTGAGAGAAAGAAAAAAAA
GTTTTTTCATCACGGGCTTGACCTTCCCATCCTCGATGCGCTCCGTGATCGCATTCAGAGAAGCCTTGTTGTTGGGGCTAATGAAGCCAACGTGCTGCGC
CCCGAACTCCGAGTCCTTAACAGGCTGTGCCATTGGCAGGATCGTGATGAAACGGCCCGTGTTCTTCTTGAGCACCACCTATGCCCCGTCGTTCCAAGCC
GAGGGCTCCACCCAGCAATCGAAAACCGCATCAACAGAGTGCGGCGGCAACACGTCCACCCACTTCTCCTCGGTGTAGTCGACGACTTGATCAGCGCCGA
GAGACTTGATGAGCTCAACGTTACGTGAACTCGTCGTCGCGATGACCCGAGCCCCGATGTCGTGCTGAATGACAAACATCCCGACTGAGCTGCTGCCGCC
CAATACGAGGATAGTGTCTCCTCGTTGAAGCTTAGCGTGCTCCGTCACCCCGGCATACGCTGTAATCGCCACCGAGGGCACCGCAGCGGCCTCGTTGAAG
TTCAGATTCTTGGGCTTCGCCGCTGCGACGTCCTCGTCCAAGACCCAGTATTCCGACAGGCTACCGATGGTGGCACCCGTCGCGGACGCATAGACTGCGT
CGCCCACCTTGAACCGCTTGACGTCGCTGCCGACCTCGACCACTTCACCGGCGGCGTCATGGCCGATGGCGAAGGGCTGCTCAGGGGACGGAGCTCGGCC
CAGCATCATTTGGCCCATGACTTCCACCAGCTTGTAGTCCAGAGGGTTCACCGAAGCGCTGTGCACCTTGACGCGGACTTGGTTCGAAGCGAGGGCCTTC
TGCGGCAGGTCGGAGCGGAGCTTGAGCTCGTCCTCGATCGGGCCGTAGTGGTCGTACTGGTACGCGCGGTAGGTCTGCGGGAAAACCATGGGGAGGAGTG
GAGTTTGTACTGAAGTGCTTGTCGGCTTGAAGGCGAATTGCAAAGTGAGAAGACGAGTCTCCGAACTCCTGAAAGCAGCAAGACAAGGTGCTCGGGCCCA
ATCCGATTAGCTAGACGTGATGACCAGGGTTCGGTAGTAGTCTCCAGAATAGTAGCGATAGTAGTACTAATATCACTACTATTACTATAGTAGTGCTATA
GCAGTGGGGTCTGGGCCTCATAGTAGTGATAAAACTATAGTAGCGAGAAAAGAGGTCACTAGTAATGATAATAATTGTGCTAATATCACTACTAATTCCC
CGAACTTCAACCCACGTAAGATCTTCAAAAGGCGCGCAAATTGGTGGTTCTCCGACCCCCCCCCCCCCCCGCGCTTCGAGCTCTTTCGCTCATTTCTCGA
TTCTCAGGTAAAGCCAGACTGATGAAGTGTGCTAATATAGACTGACATTGGGGGAATCTAGAGGAGACTTCGCCGTGCAGTGTGTGTGGTCGGCCCGTGC
ATCACTTGTGCAGCAATGAACTCTGCACCAAGCCCGACGTCGACCTCGCGAAAAGGTAGCGCTACCATTAGTGGTCTTTGCACATAACTTTTGCTTACTG
ATGCTCTACATGCAGGTTCTGCAGCCACGCTTGCGTGAGCAGGTTCTTCAATACGGACAGCGACTCCCAGGAGTTCACGCCAAGCAGCCAATCCGGCATA
TCGTGTTCCAGCAACGCCACTGTGATCGACCTCGCCCAACATGACGCCGAAGAAAAAGAAGAGCCCGTTAACAGTATCCCCGATCATGTCGTCTACAAGC
CGCCAGCAAACTCGACCGACCCGGTGTGGGAGCTGATCCACCGCTTGGATACACCTTCCATCTACGAGGCCAAGACGTACACGCATATTTGTCTGCTTTG
CGTGCAGACGAAGACGTGGCAGGACTCACTCTGCCGCGCTGGCAACGCATCGAACGCTAAGACCCATCTAGTGTCCATTCATAAGGACCATGAGTTGGCT
ATCCAAGAGCAGCGGCGCCGGCTAACCCGTGCAGACCGCTACATGGTGCAGGTGGGGCCCAAAAATGAAACCAAGCGGGAAGTTTCTCCAAAAGCAAGAT
CACAAGCAGATCACCCCCTAAAGCGCCAGAAAACGTTGTGGTCAACTTCGGGGAGCAGATAACGGGCCATATAGCACGGTGGCTGATTCATGATGGTGCG
TTTTTAAAAACTTTTATGACTTTGAAAGCTGCTAAATCTCATTATTGCTATGTGTATCTGTGCCTAGGGCATGCGCACAACATGGTGACGACTGCTGCTT
TTCATGAAATGCTCGTCGGCATTACGGGCAACCCGAATGTCACTGTACCCCCCACCAAGATGTATAACGACATTTTGGACAACCATTTCGAGAAGTTTAC
AGCGGACGCAGCTGAGATGTTCATCGAAGAGTTTCAAGAGCTGGATGAAACGTCATGACGGTGGAGCACGACCTATGGACAAACAGCGCAAAGAATAACA
TTGTTGGAGTTCAGGCAGTTATATCAACCACCAGTGGCGACCTGTACGCCTTGCTCTCCTTGCTCACGTGAAGAACGATGGACATGATTCCAAAGAAGTG
GGCAAACTGATGAATAATCAACTGAAGACACGCTACGGTCTGGATGTGAACAAAATGGCTCGCTTCACGATATCGGACACTGCTCCAGGCGCGCGAAAAA
TATCGAGGCAATTCGACTCGACCCTGCAGACGGACTGTGCGATGCACGCACTCAATCTCTGTATTGGCTATGGCATCGGGTTGAAGGAGAATGTGCGCAA
CGAGTACAAGAAAGACCCAAAGTCGGAGGCGTACGTCAAGACGCGGACTGTTGTGACAAAAGGTGGGGCATTCCCAGAAGGTGGCAAGGTGATTCGAAAA
CTACGTGCTCTAAACAACTTCTTTGCTTCGAGCAAGTCCCCGGAGCGTGTCGCCCGCCTCAAGGACGTCCAAAAATTTCACAAGCTACCCCAGCTAGCAG
CTTTGGTGGACATCGACGTTCGCGTGGCGTCCACGATTAAGTTGTTTCAGCGTTTGATCATCAACTTTTCTGCGTTCCAGGCATTTTTCCTGAGCGCAAA
CGTGGCCAAGGACGAGAAGCATGTCTTCAACCGAATCACCGACGCAGAATGGGCGTTAGTGATTCAAATGGAGGCGATCATGCAGCGCGTGGCAGAGTTA
GCACTCGTGGAGGCTCAGTCGGCGTCCATGCTTTCTTCGACTATGTATGTGCTGCTGCGTGTGGCTTCCGCTCGCATGAACTCGTACAAGTTCTCAGCCT
ACTGTCTAAATGGTGCTCGTGACACGGGGACGAATGAGAAAAACTTCCCGCGGGTCCAGCTAACGTTGCCCGATTTATCGGAGCTCGCTCAGCGATGCAT
CACGCGAACGCTTCACCAAATTGCTGAGCGTCTCCCACAGCCGTCCGTGCCTATGGGTGTGGCCTTGCTACTCGATCCACGCACGAAGTCATCTGCCAAA
CAATTCCTTCGCATTCCTGACACAGCGGAGGCTGCCACAGACAAGATATTGGAGGATGCGAAGGAGCTAATGCGCGTCGAGCACCGGGTTTTCTTCAAGG
GTCTGCATGCACGTGACAAGGAAAACGTCCACGACGCAGCGTCTGCATCAAACTCCCCACCAAGAGAGGCTAACAGTGGTTCAGACACTGAGGCTGACTT
GCTGTATGGTGAAGAGGTATCTCAGCCGTCTGAGGAGGCCAGTGCTGATGCCATGATCAACTCCAAGGCGGATGCGTTGCTAGACCAGTGGTTTGACCTT
CGAGTCGATTGGGCTGAGGTGGCTAAAAGGCAGTATCCCGCCGAAGACGAGTACGATACCGTGCTGGCTAAGCTGAGCGTGCGCGACAAAAAACGAGGTG
TTCGTGTGTGGAATGTTGAGCAAGTATGCAACAACATTGACGTCTGCAGCTGGTTTCTCGAGGCTGGGCAGAAGGAGTTCCCGTCAGTTGCAAAACTGGC
ACGCGTCTGGCTGGGACGGGGCTGCTCAACTGCGTTCCAAGAACGCGTGTTCTCTACAGGCTCCTTTGTGATGAGTCCACCAAGAACGCGGACTGCCAAC
GAGCGAGCACAAAGGCAGCTGATACTGCGCCACAATCGTCTCGAGCTCGCGCGCATGGAGGAAAGTAAGCGGCAGATCTGGTAAGCTCCGACAGTCTGGA
TAGTAGTGCTATAGTAGTGATATTAGTAGTGATAACTACTAATTTCGTTTCTTCACTACTAGTAGTAGTAGTAGTGATAGTGACTCACAGTCGAATAATA
GTAGTAGTATCACTACTAGCCAGAATTCTCACTACTACCAAACCCTGGTGATGACGTACAGCGAAGTTTGGCAAGTTGGGACGATCAGTCAGTGTGGAAA
TGTAGCCATTTTCTCGAAGTGCTGGAGGGATGTGGCGGACAAGCTAGGCAGCTACATGAAGGACCTTCACTACAAGGCAGCTTCTCATTTGTGTGGCACA
GACTGTGCCACAACACAGATACCGGTGCCCGCACTTTCAACAGCGTCCATGGCACGTGCATGTGCGTCGTGTTCAACGACCAGCTGGACACGCTCGACAC
GCTGGCCCACTTCCAGTTCCGACAGAGACCATAGGCGAAGTGTGAGGTGGCGGGCACGGCCATGGTGGTGTGCTCTGAGGTCTAAGGGAGCACTAGTCGC
ACCTGGACGCTGCTGCCGCCTCTATTTCAAACTGCGCAGCGAAGACGTATTCCTTCCCCCCGCTGCGGCGACGCGGCCTGTAACATTCCGCGCTTCATCT
GTGCGGGCTCACTATCGGTCTACAGTGAGCCGCGTAGTGCAGTTGTAGTTTGTATTCGGGTTGCAGCGAGCATTGCCTCCTCGCCAACAAGAGGCGCCAG
GGGCCATGAAGTGTAGCCATTCCTGGAGGGATCCGCCTGATTTACTTCAACTTGCCAACACAGCCAGCCAATCAGCGATCAGAACGCCATCTTGGGGTAT
CCGAGTAGTACGTAGGCGCGCCTTCTCTTTCAACACCCCCAAACAACGGAATCGCACACACAAGTGCAAGAATGGTGAAGCTTGCAAGACGCCGCGCAAT
GCCGCACCGCCACGTGCCGGAGCCCAAGGAGCCCTCGCCCTTCTTTGAGCGCCTGCGCTCGGAGCTCAAGTTCAAGGCGCGGCACCGCGTGGCCGAGGCG
GTGGACGCCGTGTGCGCCGCCTTCGAGGACGAATTGACGCAATTGACGAAACCATTGCTTCCGATGGACTACA