Description :
From Genome Similarity Track
Location :
Scaffold_51:349052- 354673
Sequence
5621 bases(100 bases per row)
CCCGTTACACCTGGTAGCACTTTGTAGTCCTTCCAACGACCAAGTCTACGATGAGCCAAGTCCAGATCTCCGGGGCGACCCTGGAGCATGCTGCATTCCC
CCATCTCACTCGCGTGGAGTGGGAAGCGCTTCACCGCCTCGTGGCGGTGTCCGGAGACGCTGTCGTCGCATCGCTGCTGAGCTCAGCGACGTCCGACCAG
CAACGTCTTGCAGCACAAGAGTTCATGGAGCGCGAGCTCGCCGATGCGAATCGGCGGGTGTCAACTCCCTCGCGTCCATCCCAGAATGACGTCGTCAAGA
TGGAGACGTCTACGTATTCTGGCGCCGGTGAAAACCGGCTTCCGCTAAACCGGTGGTTCCGCGAGATCGACATCGCTATCGCCTCGCGACGCATCGAGGC
GTCATCGGCCAAGATGAACTTCCTCCTCTCCCGGTTAACCGGGAAGGCCAAAGAATGGGCCCTCGGGAAGCTGGTTGTCGATCCCGAGGCTTCACCGACT
CTGGAAACTCTCCAGAGCGACTTGCGCCTCGCGTTTGAGCCCCCGCAAGATGAGTCTCGCGTTCGCGCAGAGTTCTTCGCTCTGCGGCAAGGGCTGATGT
CCATGCGTGATTACGTCCAGAAGACGCGACATCTGGCGTCATGCATCGTGACCAAGCCAATCGACATGGCCTCGCAAGTCCACGTATTTGTGTTCGGCAT
GCGCGAGGGTATGCCCGCTACTGCCTCACCAGAGCTGAGCCCTCCTCTCTCGAGGAGGCGTTTGCACTCGCGATTCGCGAGGATTACATGGTAGCTGCAT
CGTACGCCGCAGCCATACCTGCGGAAGCCCGGGAGTCTACCCCCGAGCCCATGGAGATCGACGCCATCAACGCGTCGAGCAATCGACGTCGCGGGTCCTA
CCGCGGCAGCTCTGGGCGAAGCAATCGCTCCCTCATTTGCTTCCGCTGTGGGAAGAAGGGTCATCGCGCGGCGGAGTGCCGCGCGCCAGCTCCCGTCGTC
TCTCACGTCGACGCGGAACACTCCTCGGTCGCTTATTCAAAAAACGACCAGGACCAGTAGGTGCGGGGCGCCCTACTGGCTTTAACGAAGGACCGGGCCC
TCCGGTGGCAGCCCAACCTTCGAGCCCTCCCGTGCTCCAAGCACATACCAATGCCACCACTACGCCGGGCGACTCGAGACTGATCATTGTCAGCCTCCAC
GTCACCGGTGCCCGGCGACCACTGCGCGCGCTCCTTGACTCAGGAGCGACCAACAACTTCTTTCGCGCGTCGTGTTTGTCGGTACTACCCAAGAACGTCC
GCGTCCGGAATGGTCCGGGCGAGATCCAAGTCAAACTCGCAGAAGGTAAGGCTCGCCGCGTTGCGCGGCGTGACGTGTCTTTGTCGTACACGTTCGACGG
CTTCCGTAGCAAGGACGACTTCTTGGTGATCGAGATGAACTACGCGTTTGACTGCATCCTGGACATCCCTTGGCTTGCGCGATATCAGCCAGAGATTGAC
TGGCTGGCCCAATCAGTCAAGCGTCGACGTGGATTCGACGTGAGCGAGGTCTTCACACACCTCTTGGTGGCGCCAAGAGACTGGCCCCACGTCACAGTCG
TCGACAAAACAGCAACGACACAAGCAGTGCACAGAGCGAGCGATGGCCCTCTCTGCATGGCTTGTGCTACGTTGTTGAACGAAGAGCCCTCGCGGTTTCG
CGAGGTAGATGATGAGGTGGTTGAGCAGCGGCTCCCACAGTACAAGACGGTGGTCGAGCAGGGGCTCCCACAACACGAGATGATGGTCGAGCAGGGGCTC
CCACAACACGAGACAGTGGTCGAGCAGGGGCTCCCACAACACGAGATGATGGTCGAGCAGGGGCTCCCACAACACGAGACAGTGGTCGAGCAGGGGCTCC
CACACAACGAGACGGCGGTAGAGCAGAGGTTCCCGCCGAACGATTCGGCGGTCGAGCAGATGGGCTCCCGTCAAATGATGCCGCGGTCGAGCAGGGGCTC
CCGCGTGTTCCCGGCCCGGTCGAGTACGGTCTCCCGCGCCTAGAGGAGGGTGATGCAACGTCGAGTAGCAGTGCGTCAGACTCGAGCGTAAGCTCGAGGA
AGTCGAAGAAGAAGTCGAAGCGACGACGCCTGAAACCTCGTCGAGACTACACGACCAGCGATAGCCCGCCGATGGAATCGGTCAGCGCGCTGGAGTACGT
GGAAGGAGGCCCGAATCGGTCGCGCAGCATCGCAATCGCGAGCCCGCCGCGCGAAGCGGCGGCGATCACACGCCTTCCAGGCTTGTCCTGGAAGAACTTT
CTTCGGGACCTCAAGGCTGGCGACGTCGAGCAAGTATGCTTGGTCACCGAGGCAGTCTCGGTGGATGAGGCGGCAAATGCGGTCGCAACGGACAGTGAAC
GTTCACGTCCGCTAGGTGCTGAACCTAAGTCTGCTCGAGAGGAACGATACCAAACGCAGTCTTGGGAGGCCTTGCGGGAGTCAGCGAATCCCGTATACGA
CACCGCCTGCGAGTACGCCGACGTCTTTCCGGATGATATCCCCGCCGAGCTACCGGCGGATCGTGGGGTTCAGCATGAGATCGACCTCGCGCCAGGTACG
AAGTACTGCGTCACCAGACAATGGCCACTTCCTCGTGATCAAGTGAAAGCGATCGATGACTTCTTCGAGGGCCGCCGAAAGGCGGGTCACGTGCGTAAGA
TTACCTCTCCCCATTCCAGTCCAACGTTCTGTGTGAAGAAAGCTACAGGGGGGTGGCGTATCGCTCACGCATTCAATAAGTTGAATGATGCCACCATCCC
CGCGCAGACTCCGATCCCTCGGAAGGACATGGTACTGGACTCCATGGCTGGCAGCGTCATCTACAGCGCCATCGACCTGACCGATGGATTCTATCAGATC
CTGATGAGAACATCTGATGTGCCTCTCACCGCCGTAAGTACACCGAGCGGGATGCTCTGGGAGTGGCTCGTGATGCCACAGGGCCTCAAGAACGCGCCTG
CCACCTTCAATCGCATGGTCTCCCATGTGCTTCGCCCGCTTCGAGACTTCGCGCCGAGTTACTTCGACGACATCTTCGTGCACAGCCGCGCTGAGAGCAA
CCTCAGTGCCGTGGACGTACATCTAAAACACCTGAGACAAGTCTTCCAGGTGATGCGAGAGAACAAGCTCTACGCAAACCTGAAGAAATGTGTCTTCTGC
GCACCGGAGATTCCGGTGTTGGGATGCTACGTGAGCAAGAACGGTGTGCGCGCGGATCCCGAGAAGGTATCGTCTATCTGTGCTTGGCCAACGCCGACAA
GCCCCACTGAGTTGCGTCAGTGGCTTGGCATGGCCAATTACTTGCACAAGTACACGAAGAATTACGCTGGGTTGATCCAGCCGCTGTCCTCGCTGCTGAA
GAAGGACGTGATCCGGGAGTGGAAATCGGACCACCAAGCTGCATTCGACTCGGTGAAGAAGAGCTTGGCGTCTGCGCCGATACTGAAGCTTGCTGATGAC
TCAAAGCCATTCCACGTCGTCTGCGACGCGAGCGATTTTGCCATCGGCTGTGCGCTGATGCAGTTCGATGATGACGAACACGAACGCGTTATCAGCTATC
AGTCGCGCCAACTGAAGCCAGCCGAGAAGAATTACCCAGTCCACGACAAGGAGCTCCTGGCAATGCGGTACGCTCTGATCAAATTCAGAGTGTACCTGCT
CGGTGAACAGTCATTTGCGATTTACACTGATCACGCATCGCTGCGGACAGCGATGAAGAGCCCTCACTTGTCGCAACGGATGGCCCGTTGGCTGTCATTC
TTCTCCGAGTACAACTTCGTTGCACTACAAGCCGGGCAAGAATAACATTCTCGCCGACGCGCTGTCTCGGCGTCCGGACTACGATCCCCGTGAAGCGCTA
GGACATCAGCTCGCTGATGAGGACGACGACGAATGTGCGGTCTGCGTGTCGTCAGGCATCAACTTGACGTTGACCACGCCCACGCTCCCGCTGGGCGACG
AGATTGCTACAGCGTACGATGATGACCCTATATACAACGCCATCATGAAGCACCTGCGTGCTCCTAGTAGTGACACGCTAAGTGCCCTGTCAAAGACCAC
GCGGAATCAGATCGATCGATATCGACTGGACGGTAATCTGCTCAAGTACAGCATCGACAGGTTCGATGGACCTCGAGTCGTCGTCCCAAACGACGCTGAT
CTACGTGCGCACATAATCCACGAGTATCATGACGCCCCGACTGGAGGACATCTCGGTCGCGAGAAGACGTACGCGGCTCTGTCGAGAGACTTCTATTGGC
CGCACATGTACAAGTGGGTAAGCAAGTGGGTCCGCACATGTGAAACTTGCCAGCGAGTCAAACCGTCTTCGACGTCTCAGGCCCCATTGCGCCCTCTTCC
GGTCGCCACGGAAGTCTGGCGCTCCATTTCGATGGACTTCATCTTCGGTCTTCCGCCCGATACAGTCGGGCGCACAGGTGTACTTGTGTTCGTCGATCGT
TTCAGCAAGATGGTCCATCTCGTTCCGGTGGCGGCCTCAATCACCGCGGAAGAGTCCGCGACCCACTTCGTCGACGTGATTTTTCGTCACCACGGCCTGC
CGGAGTCTATCGTGTCCGACCGCGACCCGCGGTTTACATCCGCGTTCTGGTCACACCTCTTCGAGCTCTTGGGAACCAAATTGCTAATGTCAACTGCGGC
ACATCCGGAGACGGATGGACAAACAGAACGCGTCAACCGCGTCCTTGAAGACGTTCTCCGCAGCTATGCAACTTCGTACACGAGCTGGAGCTCGTTCCTA
CCGCTAGCCGAGTTCACACTCAACAACGCCGAGCACTCCTCGACGGGTCTGACGCCGTTCTTCGTGAACAACGCTCGCCACCCACGTGTTCCGGCACTTC
TCGCCGTGGGTCACCCCACGGATGCTGGCGGCTCCACCCTTGGTGGGGGAGAACCTCCTTCGGTCGACATGGATGCTGAAGCTGCGCTCAGCTCTAGGGA
CAACGTGTCCGTGTCGTGGTCATCACCGGTACGTGAACCGGTGTCTCAGCACGCACCGGTAGCCTCACCAGTCTGCCGGCGCACTCGACTTCAGGGTTAT
CTTCGGGTGTAGCCAGTGCGAACGCCCTGACTCGTTCTCCGTCCAAGCAGTCCATCGAGCCTCCTCGGCATACTGCATCTCCGATAACGAGATGGACGTC
GCAGAACTTGATCGATCCAGGCAGCAAGATTCGTGAGCAAGACGTTACCACGGCAAACTATACACCGAAACCCTCGGTGCTTCCTGCCGATCGCTCGGCA
GTTGCGGAATTCGTCATGCAAAGGCAATCCATCGCAAGGCTCGTCCGCGACGCACTGCAGAACGCAGTGGACAAGCAAAAGGAACAAGCTGATAAGCACG
GTCGAAAGAACGTGAATGTATTCAAGATAGGAGATCGCGTTCTCTTATCGACCGAGGGAATCCGCGCTTCCGCCGTGACCAGCCTCGGCGCCAACAAACT
TGCCCCACGCTTCATCGGTCCTTTTCGTGTAACCAAGGCTGTGGGCGACGCCTACACCTTGGACATCCCGTCATCACTTAGACTCCACCCGACGTTTTAC
GTCGGGCGACTCAAGCGGTAC