Description :
From Genome Similarity Track
Location :
Scaffold_1670:349- 2123
Sequence
1774 bases(100 bases per row)
CCTTCCTACTCTTCTTCATGAAACTGCATCACGCCGAATCTGTTACGATTCGTACGATTCCTCAAGAAATCATAGCGTAATGCTCCACAGCTCAGATCTG
CCTCGTCTACCCAACTGGGTTCGTCATATCCACGCCAATACACCAGAAATTCACGGTAAATCCGCCCGTATCTAGTTCGCTTCCCTGACCTCATGTCGGT
GATCTTCTCGACTTCGACCTCGTCGGCCTCGAGGTCAACATTCCAGCTATCATCCGGTAGAAGGACTTCGTCGAAGTCGACGCGGTCGGATCCATCCACC
GAAAGACGGGTTTGCGGCCGATCTGGATATTCTTTGACCAACTTCAGCTTGGATACGTGTACTACAGGAACAGGCGATATTCGGTACCTGCCGTTTCCAG
CTTTACCGCGTGTTTTCCAATCTTCTCGCTCACCCGGAAGGGTCCATGCCATAGATGGGCCAATTTGCGGGCGTACCCTTCTTTCACTCGGTCCAAATAA
AGCCACACCTGCAATCCCACTTGGATTTGATGCGGACGAGCATCTTCGTTGTATCCGCTCGATCCTGTATCGCACTCCGCAGCCGTTCGTTCACCTGGGA
TCTGGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATCGCCTTGAATCTCGGTTTCTCTTCTTGGTGCTACATACCGGAATGGCCACTTCTAGGGTG
GATTTGGGATCCCACCCATGTACCAAGTAAAATGGGGTATCACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGGAGCCGTTCTGCGTACTCAT
CCCAATCCCTCTGATCCAAATCCTGGACGTACATCTTGAGTGCTCTCGTGATCGTCTGTACCATGCGCTCGGCCGACCCGTTAGCTTGGGGATGATATGC
CATGGTTGCTCGCTGTCGCTGCCCCAGGATCCGGTTGAATGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATCTCGCTAGCT
CCAAATCTTTGGAAACGCACTCCTCGTACGATTCGGCAATGGTCTGCGCAGTACTAGACGCACTAGCTTTGGCTACCACGTATCCGGTAAACAGGTCCAC
CCAAATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGATATTCCCA
GGTGACTCCCCTTAGATTGTGGACCTGCCCTTGCCTGTCTCACAATCCACACATTCCCCGACATACCGCTGTACGCTTTTGAATAGTCCCCTCCAGTGAA
AACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGGTGTCCGCCTTCCAAGCTAGCGTGATAGTGGTGTAGGACATCCTGTTGTAAGGTTTCCGG
CATCACCAGTCTCATCAATCCATCCCGATCCTCGTTGACTCTCTTCGTAGGGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACCGCGTAATCCGTAG
CGATAACGCTGTAGGATTTGGCATCTTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCTAGGATCCACGCTTCCTCGTTCTGTGC
TTTGAGGATCCGCTCGATGCGGACTCTCTTCACAAATGTTTCCTCGAGGATCTGGGGACTGGATCCAATCCTTCCTCTGGACTTAGTGACGGCCATCACC
TGGACTGTTCTTTTCCCGGATCCCACTACCACCACTTCGTCTAGTCGGTTCAACGTAACGAGATCCTGATGCTC