Description :
From Genome Similarity Track
Location :
Scaffold_260:349- 1905
Transcript NameFunction/comments
Phyag_g4042hypothetical protein PHYSODRAFT_284317
Phyag_g4043hypothetical protein PHYSODRAFT_322325

Sequence
1556 bases(100 bases per row)
ccTGTAAGCGGAGACCATGAGCCAACGCGAGTTCGAGcgcaagatggaggagcacATCGAGGAGATGCGCGTGACGCAGACCATCGCGTACTTCAGCCGC
ACGGTGGAGCTGTGCTTCTCGGACTGCGTGCACGCCTtccgcagcaagaagctggacgacaaggagacgTCCTGCGTCAACAACTGCGCCGAGAAGTTCC
TGCGCCACACCATGCGCTCGTCCGTGCGTCTGCAGGAGAGCTACGCTGAgatcatgcagcagcagcaggaccagcagcagaaataGAGCGGCGCCATTGG
CAATGACTTTCCACTGGACGGCAGGGTCAAGGACGCAGTAATGAAAAACACCAAAAAGAGATCGCAACCTTTTTTTTCGCATCGCTGCTTCCAAGCAAGC
CCGCTACATTGCATTATTGATCTTGCAGGCATGGCCTACACACAGCCTTGAACAAGCTCTTGGTGCTGGTAATACGGTGCACTGCATTGGTAGCAGCGAG
CGAGTCCGCGCCAAAAATGGGTCTATAGTATAGTGAATCCAAGATGACTCGCGCTAACGGTTTCAGCGGGGAACACCGGGCCTGCTCCTCCCATTTTCCA
ATTTCGCGCCCCCATTCTCCCAAAAAATGGCGCCCTCcccagcatctgcagctctgcagcgacttgacgGCGGATCCTCAGACGAAGCTGAGCCGGCCCC
GACGCGCGGGTACTCGAAGCGCGGCGATGGCTTCTCGGTGCAGGAGACGGAAGggttgctgcaggaggtgcgCGAGCGCTGGCAGGAAGGCTGGGACGTG
ATCGCGGACGTGCACAACGCGCAGTTCCCGGGCCACAAGCGCACGGCCAGCtcgctcaagcgcaagttcGCCAAGCTCTACCGCACCAAGATCGACTCGG
GCACCAAGGATAAGCACGCGAGGGCGGCCGCCATGGCCAAAAAGGTCCGCGAAGAGATGCGCGGCCAAAGACGCGGACTCTCCGGCACGCGCGGGCTCAG
TGAGGACCTCGTAGCGGAGACCGACGGCGTGCAGGACGTGCACGAGGACCtgacggaggtggagatgatgacgtcGCAGGCGGGACCGACACAGACGCAC
ACGCTGCCCGAAGCGGCGGTGACGGCCAGTGAACACGAGCTGCGGCAGACGCTGAGTCAGAGCGTGCCTATTGCTCAAGAGACGCCACCGATGCGCGACG
ATGCGTGGCAGGCAGCTATTAGTCGGTGGCCGGTTGCCGGTGACAGGCTCAGGACGCTGCGAGCGCAGATGGAGAACAacacagcgacgtcgagtCAGGA
CCTGATGCAaactgtgctgctggtgttgctggagtcgcagcaccagcgtgaTTTGGAGCGAGAGCAGGAACGAGAGGAACGTCggttggagaagcagcgc
tggcagGAGGAAATCCGTGAGCAGCGTCGGCGACATGAGCAAGACCGCGCGGAGGACCGACGCAGACACGAGCAGTTCATGCAGGTGATGGGCACACTGG
TCGGACAGATTGCAGCAGGACTACAGCAACGAAGCGGGTTGAACTGAATGGGGCAT