Description :
From Genome Similarity Track
Location :
Scaffold_3413:349- 1579
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_3413-snap-gene-0.1Serine protease family S10

Sequence
1230 bases(100 bases per row)
GAGGAGGAGGACTTCTTTTGCGGCTTTGCGAACCATGAAACCGGGTACATCAAGCTGCCGAACAAGAAGGATGATCACTACTTTTACTGGTACGTGGAGT
CGAGAAGCAGCCCGTCGAAGGACCCACTCGTGCTGTGGCTCACGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCGCTCCTCGCCG
AGAACGGACCCTGCCACGTGCAATCCGACCTATCGACCAAGATCAACCCGTACTCGTGGAACCGCGAGGCAAACGTGATCTGGCTGGACCAGCCAACGGG
AGTCGGCTACTCATACGGCGATGAATCCGATTACGACTCTGGGGAGTTGAACGTCGGCGAGAACATTTACTGGTTCCTGCAGGAGTTCCTGAAGAAACAC
CCAGAGCTCGCCGATCGCGAGTTCTTTGTTACGGGCGAGAGCTACGGCGGCCACTACGTGCCTGCAGCGGCGAGCTACATTATCAAGCAGAACGTCCATC
GCCATCTCCACCCCGAAGCAGTCCACATCAACCTGGCGGGTATCGCGATTGGAAACGGTATCACGGATCCTATTGTGCAGTACCAGTACAGCGTGGACAT
GGCGTTCAACTCGTACAACGTCACGTTGCTCGATGACGCGCAAATCGAAGAGATGCGCGCTGCGCAACCCGTGTGCCANNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGATGCGTTGGAGTTTTGCTCCGAGACGCTCGAGACGCCATATTTCCTCGCGAAGCGCAACCCGTAC
GATATTCGCCAAGCGTGTGACGAAGAGGACTTGATGAAGTGTTTCCACTTTGAGCACATTGACGCGTACTTGAACTCGGAGAGCGTGTTGATGCAGTTGG
GCGTGGACACGAAGCATTCCAAGGCGTGGAGAGAATGTGACGGGCACGTCGGCTCGGCGTTCGTGTACGACCAAATGCGCTCGTTCGCCGACGACGTCAA
GCTCGCGCTCCACTCGGGCGTTCGCGTGCTGATCTACGCTGGCGATGCCGATCTGATGTGCAACTGGGTGGGCAACCAGGCGTGGACGCTTGCTTTGGAC
TGGAGCGGCAAGCAGCAGTTCAACGATGCGGAAAGCCGCGTGTTTGTGACGTCGGAGGTCGCCGACGCTGGTCGCGTGCGCTCGTTCGAGAACTTTGCGT
TCGTGCGCGTGTTCAACTCGGGCCACATGG