Description :
From Genome Similarity Track
Location :
Scaffold_240:34895- 36654
Transcript NameFunction/comments
Phymu_g7372hypothetical protein PHYSODRAFT_558741
Phymu_g7373hypothetical protein PHYSODRAFT_543712

Sequence
1759 bases(100 bases per row)
GAGTCGGCACTGTGCCAGGACGCGATGCTGCTCGCAGCTTCAGTGCGTTGGATCTGATCTGAACGTCTGCGAGACGTTTGCCATGTAATTTAACCACTGC
AATCTTTGCAATCTTTAGGAGGGACCATCGGGGAGCGgaaagcccaagaagaacgatTCGGTGGAGCACATCATCGATGTGGTGCTGGGAAACTGCGGCG
AGCTCACTCTGGCTGGCAGCCTGGGTTTCTGCTCGGGCTACGCTCTCAAGACAGTGGGGAAGGCTGCGGCAGTGGCTGTAggcatcgtcttcatcctggC
ACAAACTGCTGCCTACAACGGCTACATCGACATCAAGTGGAACAAGGTGCAGAAGGACATGATCGCCAAGGTCGACCCGAACGGAGACGGCAAGATCGAC
AGCGAGGACGTCAAGCTCTGGTaccggaagctgctcaaggccatgaagacgaatCTGCCGTCGTCCGCGGGCTTCTCCAGCGGTTTTGCGCTTGGCATCT
ACTACTCGTAGGTGATTTATTGTCTGAGTCACAGCAATGTGGTAGTGGACCATTTTGTGACAAAAAAATACACATCACATTGTTACAAAATGCTTGAGCC
GTCCGTCCTACTCGGTTGGGAAGGCCTTGGCTAGAAATCCGACGATGATAGAGCGGTCGTCTGCGCTGGTCACACCCATACTCTTAAGTTCGCGCGAGAA
TGCCGGCACGCTGCTGATCCCGTTGCTGATAAGGTTAAGTCCTAGTGTGGCGTACAGAATGATCTCGGGCCGCGTGAACGATAAAAATGTCTGCTTGGCG
CTCTCGGAGCACGTCGGGAAGCAGTCCTGCCACATCTTCTCACGTAACCGCGACTTCATGTCATTGTCCGCGACCTGCAGCGAAGACAAGTAAGTTGCAG
CCTGTTAAACGCCAAGCAACCAATTCTGGACGTTGAACTATGGCCGTACCGATACAGGAATGGGTGGAGGCATCTCGACTCCATCTTGCTCTGTCTACAA
TCATTCCCAAGCACAAATACATGACTAGCAtcagcaaccagcagctcaaacacgTCCATGGCTTGTCGAGAAAGGGTGTGCGTGGGGCCCTACCGACAAG
CCAACCTTACGGAGCTCGTGGGCACGGAGATGGAATCCCCGCGCGGTCAACTGCGTCGCCTACAGCAAGGACAGCACCAGCCAACCAACGATCACATCCC
TAGAGTGGGTATCGTCGCGCAGTGTTTTTCTCCATGCCCAAACAGCACAAAGATcacacacaaaaaaataGATCGTACCGTCGGGTCCTTTTCAATGTAG
ATCCGGTACGCCTCTGTAGTCCGCAGTCGTGGAGTGTACAACTTGGTCTTCCACTCCTGCTTGCAACAGGCAATCGCACTAATTAACCAACGTATTTcaa
agccagcagcatccatTCCTTCGTAcctccgtctcgtcctcgtcgtagtcgaaTTCAATGGGCGCGATCCAACCTCGCTCCAATAGTCTGGCTAAAATGT
GTCCAGCCATTCTTGTCCTTGCCTCCCCTACCAGTGTCGTAGCTGTGGCGGTGGCAGTAGGAGCCGTTGACGCGCTGCCGTCCACTACCAAGTCTGTGTC
ATTCTTCGTGGTTGTCATCTGCGtagtgaagagctgcacgccgTCACGCTCCAGCCACTCGCGCAGTACCGTCTCCTCCATGAACTCCATGTCGTTCTCA
TCCGACGTCTCCAGTATGCCcgcgtgctccagcagcacgacgaacTCGTCCTCGCTCAT