Description :
From Genome Similarity Track
Location :
contig_47:348902- 352623
Sequence
3721 bases(100 bases per row)
GTAAATCCGCGGCCAGTTCCTGGGACTACAGCAGTGTTTCCTGTTATCATTCGTGTCTTGGTTGAACTCACCGACCCGAAAACAGTGTTCACTGTGGGTA
GGTTCGTGGTATGACTGAAAGTTACGGCGCTAACGTCGTACCGGGCCGGAAACGTAACATCAACTCGACTACCTGACGGCAAGTAGGCCGAGTTGGCAAA
CGCAACAGTGTAATCCGTGACAATACCGGCCCAGTAAGATATGGGTGTCACCGTCGCCGATGGAAGCGTTGCGCTCGTGTAGGTGAGCCCAGCCACTGCC
TGGTTTTCCTGGAATATGGCCCCGGTAGGGTGCCGTGTGTGAACTCCAAAAACTCCCGAGGCTTGAGCCGCCGGATTGATAATATTGCCATACGTGATCG
ACACGCTCGTTCCGGCAGCAACGTCTTGGCCAGCAATTGTAAGGCGGATATAAGGCGAAGCCACTTGCACTATCGTCGAGGCTACAGCAATGCCTCCCAG
ACTGGACAGTGTCGCGCCCGTGAAGACAATTGTGCTGGCACTGAGAAGCGGGAACTGCAGTGCAATCACGCTCCCAACGCGTAGTGTGATGCTCGTCGTG
AAGGAGATACTGTACGCTGTCGTCGTGCCGGCTACCAGGTGATGCCGCTGTCACTACCGGGCTGGAAATCGTTCCTAGAGTGATCATCGATCCCGGTACA
GTAGCTGACTCGAGGGTCGAACCGCTTGCACTTTGCGTGCGTATCAAATACGTGGAGGTTGTGCCCGAGCCTGTAGTGCCTGTAGCCAAGTTGGTTTTAC
ATCCTATTAGTCTTCGCAGCTCAAAAACCTCCGTGTGTCATTCGTTTTACCTGGATTCGAGATACCGTCGAGAGTGAAGGCGATCGGTCCAGCAGTAGCG
TCCGTACCGGCCACCGCGATCGTGACTTGTGCGCTGGCAGGTGTTGCTACCATTGAACTGCTCAAGTCCAATCCCGAGGTGATCGTGAGCGTCGTGGAGG
CTACGTAGAAAGTGGAGGGGAACATGACCGTGATCGTTCCGCCGACAGGGACGGTAGTGCCTGTCGTAAAGGCCACGCCCACATTACCCGTGACGCCAGC
GACAAGAGACGCAGGTGTGATGGTCGCAGGCGCGATGGCTGCATATCCTCGCTCTGCGCATGACAGCCACAGCAGCAATTGCAGCCACCACATCGCATCC
ACCCTTTCAAGATCCGCCAACTTAGACTTACTTTAAAGATTACGCAATCTCTAGTTTAGTTTCTACATCGGTTTCTATAGATGTAGGAACTGCTCCCAAA
TGAAACGAATGGCGGGACCCCGGTGCTCTCACCACAAACCGGTATTCATGAAGTTATGTATATTACTACTAGTTGGAGTGCAATGAGGTAGCCTAGTAAC
GTACTATCTATCCGCTGTGTTTGTGCTGAAGAACTGCAGTATTGATGGTTGGCTGTTGCGCGGTCGTAAGTTGTTTTTGCGTGGTCGGCCTGGTCTTCGC
TTGGGTTTCTTTTGCTGCTCCCCTCATCAGTTGAATCAGGTGTCTCCGCGATGGAATCAGCTTGAACTGAAGCATCGAGAATGGCTTCCGGTACGCTCGG
GTAGTAGTGTAGATATTGTGGTGGAATTGTGAAGTATTTGGCCGACAGCGATTTCAACTTCTTTTCCGCTAGCTCTTTGATCGGATGGCGTGGAAGCTGA
ACAGACGCAATTGACGCCTGGAGTATGTCTGTGACAGCAGGACCAAACAGTTCCGCCAAGACGGCCCTCCGAATACTGTCAATGTTATCAGATCTTAGCA
TTGCGAACGAGATTGACTCCGATTCCGGCGTACCAACGGTTTTGCGAGCGGTACAAGTGCCTTGATCAATCTCGAACAGATAGTTAGCAGTATACCCTGC
AGGAGGCGGGAGGAAGTACTTGCTGAGCAAAGCGTTCCAGTCCACGAAAAACGGCCTCTTGGAGTCGTTGTGGTCAAAGAACACACCGTTCACGCCCTTT
ACTTTGTTTACTTCCTTCAAAAGATCCATCGGTGTGTAGAGGTTCAGACCTTGAGTTGCCTTACGGCACCAGGCAATAACGCGGTCCGCAACGTTATGAG
AATGACCAGGAAGCAAAAAGCACAGAACAACTTTTCTGTAGGGGAACACTATCGAGAGCATTGCGAAAAACATCAGAACGGCTTTGGACTTATTTTGCCC
AACACAGTTGTCCAGCAAACTGAAGCTGACTTCGGCAGCAGGCAGACAATTACTTGCTGCTTCTTGCACCTTTTTGAGATGGTAAAGCAGCCTTAAGCTG
CAGAGGGCATCTGCATCTTTACCCTGAGCTCTCTCATCGTAGAAAAAGACATGGTTGACGCTGTTGCTGATGTCTGCCACGACAAAGTTCTGCAAAATGA
GGTTGCTGTTATAATAGTCGATCGACGGGCGAGAGTGGCCAAAGTAAGGCATCGATATACCACCACCATAGTCCTCCGCTTGAATTTGCACCCGACAGTG
CTGATTCGAGGGACGTTCGCCTGACTCGGCTGTAGCAGCATCGAAGGCGTCATCCACATTTTCCATACAGTCCACGTTGCCATCGTTGTCATCGGCTGTA
TCCGGAATGATTTCACAAGGCAGGTACTGCTCTGGTGCATGGAGGGCCGTATAGTTTCTGATGAACGACGAAACAAATCGTCTTTGGGAGATAGCTTCAG
CAAGATGCATTTGCTTTTGGAGAAGAAGACATTTCCGTTCATCAGGAGTGATATCCTCTTGTCGAAGCTGAATATCTAAACGAGTGCAGCAGTCACAATC
GTCTTCTGTCGTTCTCGTTAGACGGACACCGGGATATAATTTGCGGACGTATTGAATGAAACGAGAGTAGCTCATTGTGCGAGCGCTGGGATCATCGCGC
TTGACATCATCTTGATATCGCGCATGGACCACAGTCCAAGTTAGTCCTGCTTCGTTGAAGAATTGACGAGGTCGTCTATGGGGGCAAGGAAAGCCGTCTT
CCAGTATCCATGTCGAGCAGTGTGTCTTAAACGCAGCCAGGTCTAAATCACTAAAGGCATGCCACGGGCAGCAGGAGTACGTCGGGTGTGCAGTGTATCA
ACCCCTTCCTTCAAAACTGTCCTTAATCTTGCGATTCGACTTCCTCCTACGGGAAGAATGGCACGAATAACTCGTTCAGACAACCCTTGCTGAAGAAGCT
GCAAGATAGCGCCCTCTGACTGCTCCCATTCACGTCCTCCAACTCCTGTTTCCCAGGAAGCCCACTCACGCCTGATTGCGGCGATCTTCTCCTCGCTGAG
GAGCTCAACAGCGCGGGCATATGCCGTCTCCTTGCGATCAGCTCGTTTGCGTCTCTTGCGTGGGGGTATAGTCGATCGGGAGCCCCCTGTGGCTCGAGAT
GACATGCTTGGCGCTGCTTCGAAGGACGCTAAGTGGTTAAGGGGGCATGCCACCTCGACAAAAATAAATAACTCCTCAAGCGAAAGGTATTTTATGCGGG
ACCCCGGGGTCCCGCCATCCGTTTCAATGTATAGCGCTGAGTTCGAGCACCTGGACTTGAGCTTTCTTTCGCAGCGACGCCATCTCGCGCCCAGGTTCAT
GTTCAGCGAGCGGGTGCAGCTGTTCGTCGCCACATCATTCGCGTCCTGCGCGTGCATGACACGGTCGAGACGTCCCATGATTCAATCAGCGCCCCACACA
GCAAACAGATTATACAGCCCA