Description :
From Genome Similarity Track
Location :
Scaffold_1054:3488- 7394
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1054-fgenesh-gene-0.3Major Facilitator Superfamily (MFS)
Pytve_DAOMBR484maker-pve_contig_1054-snap-gene-0.5Conserved gene of unknown function

Sequence
3906 bases(100 bases per row)
TTGAGCCACCGCCAGCCCGACGGAACACGCGTGATCAGAAAGTAACCCAGCAGCGCTGTGCTGAGCATGCCGATAGTCAGGCACAGCTGGTGGAAGGACG
TGATCTGTCCGCGAGCGCGCGCTGGCGAGATCTCGTTCAGCAGGATCGGCACCGTGTTGGTTACGATCCCGGACGCAATGCTGTGTTCAACATGCCACCG
TGTAGCACTCGCCAACCCAACAACAGATCGACAGCTTCAGCGTACCCGGTGAGGAATCGTGCGACGTAAATGGCCTGCTTGGAGGTGGCCAGCGCACAGA
TGATGCCACCGGCTACGAAGAAGGCGTTGTTGAGCAGGATCGTCTTCTTGAGACCGATGTGGTCGCCGACACTGCCCGTCGTGACCGCAGACACGACGGC
GCCGATGACCACGAGCGCCGTGGNNNNNNNNNNNNNNNNNNNNNNNNNTCTCCTGCTCCGCAGTCGAGAGGTTGATGTCGATCAGCAGCGAGCCGACGGC
ATCCGGGACGATGCACACGTTGAGAGCACCGGCGCCATAGCCCCACATAAAGGACGACAGCGCGATGATCCACGCGGCCAGCAAAAGGTGCCGCGTGCGG
CCATCTTCCGGTCTAGCGATCACCACCGCGGCGCCGGGGGGTTTCGAGCCGCAGCTGAACCACCCGCTGGGCTCTGCAGGCGCCGACGACGGCAGGAGCT
GCTCCGTCATGTCGATCGCCGACTCGGAGGCGCTCATTCTTTCCGAGCGAAAAAGCTCCAGACGATGGGCGGCGATCTTGAAGTCTCGTGTTTGAGAGGG
GATTGTTAAGTTCGCCGAACTTTGACTATCACATGTGGCCCACATGAAACTGGGTCTATGTTGATTTTATCGACACATGGTGGATCTGTGTGTTGAGTCC
GGGGTTGAGTGACATCATGAGTCGCTGGCAAATGAGTGGCTCGGCCGAAAGCAGAGCCCACGGCGACGGTGTCACCGCACTCACCTTGCATTGCAGACGC
TGCGCAGGTCGTACGCTCGCTCACAGAGGCGGTGGCGCTCGCTTGCTTGCAACGATCGTCGCGTAACATGCCGGGCCGCGTGTCTTTGCAGACACCGTCG
CTGGGATCTGGGAATTAAAGCGTCGCATGTCGCAGACGCGGCCCCGCTGGTACATTTTGCCGCCATCTGGCTGGCACACGTTGAAATTGGTTTACCCGAT
TGGTGACCTCGACGAGGTCGGCAGTTGGGATGTGTGACCTTGTCCGAGATCCATTTGGACACTTCAAAATGACGCTGGGCCGCGGTTTTTATGCGGCCGC
GAAGGCGGAATATCGCTTGCTCACAGCTCCGAAGCGCTGGCGTGACTCAACCCGTTAAATGAGCTCCATACAAACTGCAAGATCACAGCGACATGCAGCC
GAACAAACCTATCATTTCGCATTTTCCTGTTTTACGGCGTGCTGCTTGGATCGTCTTCATGCGCCACCCGATCAGCAACTTCAACCGTGCACACCTGAAT
GCTTGGCGCATTTTCAATCAAGTTGGAGACCGCTAACCTACTCTTGACGGCACAGCGTAGGCGCCACGACCGCCGTGGAGGCACCGACGTGGCGCCATCC
ATGCTGCCTGCGTACAAGTGGAACGGGCACATCTTGGACCGATTTCGACGCTCTTGATCAATCTCAAGTCTATGCTCTTTTGCAGGTGGGCTGCTCGAAC
ATGTCTGCGTCGAGATCACCCCGTGTGTCCAAGGCAGGGCCGAGCGTGCGGGCGTGGGGAGACTGATATGCTCGCGGCTGGGTTCTCAATGGCCAGAGTA
TTCAGCGTGCGCTATGTTGCTCAACTCGCCATCAGGCAGGCAATCCGTCGCCGTGCAATACAAAGTGCGACAATTGGGAATAAGGTTCAAGGACACATTC
TAGCGATCGTCAGCGTCTGTTGCCAACAAAATATCTGGTCCCGCAATTTCGCAATTTCTTCCAGCAAATCAAATCGGAGGACCAAAACTACGATATGCCA
TGGACTTTTGATCCATCATATTGTGTCGAAGTGAGCCAAATTCACTCTCTCTGATTTATCCCCATCATACATCCTCAAACATCCTCGCACTCGAAACTGC
AACTGCAATGCGTCCTGCAATCTGGGCGGAGTTATTAGGCGTGCATCAGCGCATGCGACCACATGCCGTTGCCGGCAGCGGCAGCATCCGCGAACGCGCG
AGACATCCTCCATTCCCGGATGATGTCGCCACACGAGGAGTCAACGGCCGCTAGTGTTCAGATAACTGCGGTATTTTTAGCGAGCTAGCAGAATGCAGCT
TCGAAACGAAATGGGTGCGCAAATTGAGGCGAGACGAGGGGGAGTTTCGCAACAGCCGGCCACTCGACAGGCGACGCTGCCGCTGCTTCGCATGTGGCCG
CTGCTTCGCACGTCCGCCCGTTGGAGCGTGCGGGTTGTTGGCGCCAGTGGAGAGCCGAAAAACGTTCTGGACACGTTGAAGGATCACCAGAATGTTCGAA
ACCACAGCGGCGCTGGCTCGCTTGCGGGGTGGTTCGCCAGATATACTTCCAAAATTCACTTGGGACGAGTATGGATTTTTGGCTTTGCGTATGCCAGTCC
ACTGCTGGCGCCTCATAAATCCAGTGGGAGTTGAAGTTGCCCGATATTTTGGAGTGTGCTCTGAGAGAGGAGGGTTTCCGTCGCACGCAGGACAATTTTG
AGCGGGGCTGCGTCGCAATTGCAATCACACACGGCCGAGATTCACGAGTTGGTTTTGGGCCACAGAATGGGCAAATCTCCCGTCTTGCTTACTGGACGGA
AATGTCGGCGTGTTTGCCATTTTACCCATAAAAGGTTTACGCTTGTGGCTCCATTTTGTCTGATGGCTCGGCAGATTTTTCACCCATTCTCTCTCACATC
GCTCATCCGGTGCGGCCAGAGGCTCTTTCAGCAGACGTCAGACAACAAAGCCCCGGTGAGGGTAGGGTCGATGGCTCCGTTTTTATGTGTCCCTGTCGCT
TATTCTGCCGGGCCTCGACGGCTCGCATACCCAAATCAAGCCGAAATAAATCGTCAGCCGGTCGCGAGCAACTGACTCTCCTCCCTCGCAGCCCTTACCC
CATTACACGATTTCAGCAAATCACCAGCGTCGATTCGCGCCGCCACCCGCCAAGACGCAAGTAAATGACCAATCCACTGTCGACGAGACAACCGCTGGAC
CCAACCCCTATGTTTCCTCCCCCGACCCCTTCTTCCGAGGTTTGCTGCCCCCTCTCTCCCAGGCGCGCCTTTGGTCGCCGACCGCCCTCCTCCCCCCGCC
CCTCGCGCTTCTCTTGGGCTCGGCCATTTGCGGTAGAACGCTGTAGGAGAGAAAGAAGCGGCGGAAGCGAGTGGAGGAAGCGAATTCCCCCCAAGCCACG
AAGGCACCCCCAACATGTGCCGACCCATTGAATCGCGCGATTCTCTGGGGGCCATGGGCCCGGCAGCGGTAGCGCTGTTTGCCGGGTACCAGCCCGCAGA
GACGATGAAGGCCAACCCGAAGCCCCGCGCCGGCGGCGCACCTGCCGCGCCTGCGTGGGCTCTCGGCGGCGACATGGCGGCGTTCGGCGCGTCGGACGGC
ATGAGCATGCTGTCGATGACGGCGCCTCCCCCGGCGCTGCCGTTCGTGTCGTTCCCGGCCGCGGCCAAGCCGGCGAGCCTGCCGACGATGTACGGCTCGC
AGGACATGCTCGGCTTCGGACTCGGCGCGGACCAGTTCGCGCAGGACGAGTCGAAGCCGGCGGCGGACAGCTTTGAGACGCAGGAGCTGGAGGAGCTGTT
GGACTTTTCGCTGCCGGACGACGCCGCGGCGGTGGAGAAGGACAAGGCCGAGCTGGTGAACCTGGACGACGGGTTCGACGGCACGGAGATGTCGATCCTG
TACAGC