Description :
From Genome Similarity Track
Location :
Scaffold_652:3488- 5136
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_652-fgenesh-gene-0.2Cryptochrome

Sequence
1648 bases(100 bases per row)
CTGAATGAACATCGACGGCGAGTGCACGGCGTTGTAATCCGAGAAGAAGCAGCTCGAGCTCACCCAGAGCCAGTTGCCGATGTTGAGCGGCCAGTCCAGG
TCGATGAGCTTCTCCTGGAAGAAGTACGCGCCGCGCAGCCACGATATGTACAGATCCCCGCGTGTGAGGAAGCACGCGACCGCGTGCCTCGCGACGTGGT
GCGCCCAACCCTCCTGCTCGATCTGGCGCATCACCGCGTCGATCCACGGGTACCCGGTGCGGCCGGTCATCCAGCTCTGCAGCTGCTCCATCGCGGCTTT
CGTGTCTTCGCTCCATACCGAGTCTGGTGGCGGCACCTGCTGCAGCTTCCAGTTGATCTTCTTGCACAGCGGGTTAAACTCCTGGGTGTCGAAGTTCGTC
ACGCCCACGCAGTAGCAGTAGAAGAACTCGCGCCACATCAGCTGCCCGTCGAGCGTCACTGGTGCGGGACCTTTCAAACCGGGAAACTTGAGCTGAATAA
ACATGATGCGGTAGAAAAACTCACGCAGACTCACACATCCAAACGCAACGTAGGCGCTCAACGCTGTCGTGGACGGCTTCTCGAGACACACGGGTGACGT
CTTTGGTTTCTGGAACAGCCCCACGCGCTCCTCGTTTGCGCAGAACTCGTCCAGCGTCTTGAGTCCGACCGTCTCGCCACCGTACATAAACGGGTGGACC
TCCGGTGCGCTGTGGCCGAATGCCTCGAGACTCGGGATCACAAACGGTTCGTCCCTCGGCCCCGCGATCACCGCGCCGCTGAATGACAGATACGTGCGGC
AGTAGGTGTCCAACATCACGTACAGCTGGTCCTTCGAGAGCGTCCACCCAGGTACGAACCCCGGGCTCGAAGTTGGCAGACTAGGCTGCGGGAGCTCTTC
GACGATCTTGAGGAACTGCGCAAAGTCCGTCAGCGGCTCGCCTCCGTTCATTTTGATGACAGCACGGGGGTCAAACAGCGTCTGGCCGTGGAAAGTCGCC
ACGTTCACACTGAAGTGGTGCGCGATCGCGCGCACGTCGTTATCCTGCTTGATGCCAAACGGCATGACAAACTCCTCGAAGAACAGGTCCGTGACGCCCC
ACGCCGGGAAGATTACCTTGAACACCTCGGACGCCTCGCCGCGGAGTACCGCGAGCCCCGAGTGGCGCGCTTCCAGGCTCTGCGACAGGTCGAGCACGCA
CTCGAGCAGGAACTGGAACCGCACGGCGCCGCAGCGCTTCTTCACCGGCCGGTGGATGATGTAGATTGGGATGATCTCGGCGATGCCCAGGTCGCTTATC
GCGCCTTGCAGTGCCGAGTTGTCGTGCAGTCGCAGGTCCCGCCGGAACCACACGAGCGCCCGTCGACGAGGTAGCGGAGATGCCTGCTCTACCGGTGACT
CTTGTATCAGCTGGGGCTCGATCGCCTGCTTGAACGGTGACTCGGGCTCGAAGGCACTGACGTCGACAATGTCATCGCCTTCGTCATCGCCGTGCACACC
TGTGATCTTGTCTGCATTGTCGTCGTCGAACGGCAGCGCCGTGTACATGTTCTCAAAGTGGTGCTGGCGGTGGTCGTCGTCATCATCATTGACGTCCATG
CAGCTCTCGAGTGTATCAGTCGCAGCGACGCCTTGGTCGTCTTCGTTG