Description :
From Genome Similarity Track
Location :
contig_9:3488- 4552
Transcript NameFunction/comments
g2570.t1POM75920.1 Reverse transcriptase [Phytophthora palmivora var. palmivora
g2571.t1hypothetical protein

Sequence
1064 bases(100 bases per row)
GGGCGCCTTCGCTGGACCTTGTAGGTCCCCAATCAGTTTCGGGCGCATGATCTTCATCACCCGGTCTTCGGCCAAGAACTTGTATAAGTCCTTCCGGTAA
AATGCAGACTCCAATTGTTCCTCCGTCCACATCTTGCGATCTTCCGGGTCTTCGGCATCCGACTCCGGCGCTTTCATCTTGGTGCGTCCGGTCGGCGACC
GCTTCTTCGACGCTGATCGCGAAATCGGAGGAGTAGTTTTGGGTGAAGATCCTTTGGCTTTCGCCATCGGATCTTCATCCGGCGGATCACGATTCGCATC
GCGATCCGCGGGGGTCCCCGAAGGGACCTGGGGAGGGGGGTAAGGCTTCTCTTCTAGGTCCATTGCTGAACCTGCCTCCTTCTTCGTATCATCAGAGTCC
CTCCCAGTACTCTGCTGACTCGATGATCCTTGCGCAATCAGCATCATCGACGGCGATCCATCTTCCGTCGACGACTCATTCCCTGGTTTGATCTTGATCT
TGACATCCTCTTGGTTAGACTCACGGTGAAATCCCTGTGAGTCACCAGAAGATCCGGGCACGCGCACCATTGTGGCGGAGCGGGATCACAAATTGCTGAT
GTGACCGGCACTCGCCAACGGTTGCCCGGACTGCCGACTGTCGGAGGGGGTACTCCGTTGATCCGGTGGATCTTGACCTTGTAGCTCACCTTGTGTACCC
GACGGCTTGGGCGGGTTGCACTCTTCCGGTACTCACGCGAGGAGTATCAGTGGTGATCGAGATCGGGGTTTGAGCTTGATGGGCTCTTCAGGGGATGGGG
GGTTTGACAACTACGCGGATATGCTTCACGCAGTCGGTCGGTATCAGGTGTCGATCGTGTGTGGGATCGATCACAGGGGGTTGTTTTCCTTTGCGGGGTC
CTTTACGTTGCTTGCCGCCTCCTATGGCGGGGTCTTGATGAGTTGAGACAGAAGGGAGAGCGCGCCTAGCCAAGCGATCTAGGGGCTTCCACGTTTACAC
TTGATTTCACTATGTGGGTTGTCGGGTCGTCGGGTAGGCCAATATACGGAATTCCGCTGGCCAC