Description :
From Genome Similarity Track
Location :
contig_31:348730- 351156
Transcript NameFunction/comments
g7522.t1hypothetical protein

Sequence
2426 bases(100 bases per row)
CTGACAAACGTGCATTTCACAGCCAAGAAAGGGGACCTGGTGGTTGTTCGTGGCGCTGTGGGGGCCGGCAAGTCGTCGCTGTGCGCTGCGTTGCTAGGAG
AGGCAGAGAAGCTCAGTGGGGGAGTGTTCGTTCGAGGACGCGTGGCTTACTACTCGCAGCAGCCGTGGATCCAAAACATGACTATCCGTGCCAACATCCT
CTTCGGCCACGAGTTTGACGGCAACAAGTACCGCAAAGTGCTGGACGCGTGTGGTCTTGTACCGGATCTGAAGCAGTTTCCAAGTGGAGATGCAACTGAA
CTCGGCCCCAAAGGGGTCAACTTGTCGGGCGGACAGAAGGCTCGAGTGAGTCTGGCTCGCGCGTGCTACGCCGACGCCGACGTGTTTCTACTGGATTCGC
CTTTGGCAGCAGTCGACGCTGTGGTTCAAAGCGAGATTTTCAGCAAGTGCATTTGCGAGCTACTCGAGGACAAGACGGTCATCTTGGTGACGCACAGCCC
CGAAGTGATTCGATCACCCGCTGTGAACTACCTCGTTACGGTTGGAAAGGGCTCGATCCTTTGCGAACGACGAGACCCGGAGCTTCGGCGAAGCGCGTAT
TCAACGCGCCGAGCTCTCGCTGGGTCTCCGCAACCTGTGGAGACTGCGAGCGACGCTGTAGATGAAGCGAGTAAAGGGCGATTCGTGGAGGAGGAAGTGA
GACGAGAGGGACGGGTCACGAGCGAGGTCTTCTGGGTGTACTTCCAGGCGCTGGGCGGGATGAAAATGTGCACTCTGGTGCTCGTGTCCCAATTATTGTG
GCAGGGCTTCCAGATTGGCAGTGATCTGTGGCTCAGCCATTGGACCACGGAAGGCTACGGCGTTGGCGCTGAAGAGACCAAGGAGAAGATGCTGGTTTAC
GCGCTTCTGGGTGGGGGAGGAGCGCTGATGGTCCTCGTCCGGTCGGTTTGCGTCGTGTTTGTTGGCCTTGGTGGTGCTCGGTACTTGTTCACAGCCATGA
CCGACGCGCTGATGCATGCTCCCATGAGATTCTTCGACACGAACCCCATCGGCAGGATCGTGAACCGCTACTCGACTGACATGGGGTCGATTGATTTCCG
TATGCCGCTGATCTACGGCGGCTTCTTGGCGGACTTCTTCGTCGCAGTGTGCCAGCTAGCAACTGCTGCCTACATGGTCAACTGCTTAGGCCTCCTCGTG
GTTCCTCTCGTGTGGCTCTACGTCAAAGTCGCAAGCTTTTACTTGTCGTCGTCGAGTGAAGTGACTCGGCTGCAGCGAGTGGTCTCGTCCCCAGTGCTGA
GTCTCGTGAGTCAGTGTGAAGAAGGGGTGACTGTGATCCGCGCCTTTGGTCCTGAGTGCAGCTCTCGCATGGCCGGCGAGATGCTTGAGCGCATTGACGA
GAGTAACAAGGTCGCTTACGTCAGGACGGTCACGGAGAAGTGGTATATCGTGCGGATCCAGCTCATCGGCTGCGCTGTTGTGGTCGCCATCGTGTCGGCG
CTGGTGTATCTCCGTTCGCTCTTGTCTCCGGGGCTGGTTGGCTTGGCCTTCACGTACGCGCTCAACGTGGACGAAGGGCTGGCGAACATCGTCCGGCAGT
GGTCCTACGTGGAGCTCATCATGGTCAGCCCCGAGCGCGTGCTGGAGTACGCTTCGCTCGCGCCTGAGGGCTGCAGCTCAGCTCTTTTGGTCGAACCCGC
TGCGGAGTGGCCTGCTCAAGGAACTATCCAATTCGACCGAGTCGTTTTCAGCTATACGGGGAGCGGCGAAGACCCTGTGCTGGACAGCGTGTCCTTCAGC
ATCAAGAACAACGAGAAGGTCGGCATTGTGGGCCGAACTGGAGCGGGCAAGTCGAGTCTGACCCTGGCGCTCTTCCGAGTGAGCGAGCTGGTGTCTGGCC
GGATCTCCGTCGCGGGGACCGACATCTCGACGGTTCCACTCCGCTCGCTTCGAGGCCGCATGTCCATCATCCCGCAGTCCCCAGTTCTCTTCAAGGGGCC
TCTTCGGTCCTACTTGGACCCGTTCGACGGGTTTGCAGACTCGGACATCTGGTCGGCCTTGGACAAGGTGGGGATGAAGCAGAAGGTCGGGGCCTTGGAG
AACCGGTTGTCGTTTGAACTGGGCGAGAACGGCGAGAATTTCAGCGTGGGCGAGCGGCAGTTGCTGTGTATGGCTCGTGCCTTGCTGAACCGCAGCCGGA
TCGTGGTGATGGATGAAGCCACGGCGGCTATCGATCATGACACCGAGCAGAGGCTGCAGGAGATGATCTCGCGCGATTTCGCCAACGCTACCGTCTTGAC
GATCGCCCACCGTCTAGCCACGGTGCTCCATTCCGACCGCATTCTCGTGCTCAGTGAGGGGAAAGTTGTGGAATTCGACACGCCCAAGAAGCTTGTCAAG
GACTCGGGTGGCGTCTTCTACGAGCT