Description :
From Genome Similarity Track
Location :
contig_21:348721- 351477
Transcript NameFunction/comments
g3884.t1hypothetical protein PHYSODRAFT_327665

Sequence
2756 bases(100 bases per row)
GATAGCGGGGTTCTCAAGCCTGTCAACGACACCTCGGGGACCCCGGAGGTGGTCTGCTTCGGTCCGTTCCCACAGCGCTGCTACGGCTGGTACTCGCGTC
GACTGCAGGACGTCTTGGACGAGCACCGCCGCCTGGAAGCGACGGGTGACAGTGAACTCAAGGACATTGAGTGCTTCAACCAGCAGTCGAGACTGCGCTG
CAACTGAGCAGGCAAAAGTGACATTTGGATGGACAATCCCCAGAGCTTTATGTTACCGAGCCTGGCGACTGGAGTCGTGTTTGGGCTCCTGTGTTTTGGT
AAGCAATATGAGACCCCGCTCGCTACCTATTTCAGTCTTCGAGCGAGCTTCAATGTGTATTCTTAGTAGAGCGTCCTTCGCCAGGTGACAACCTTGAAGT
CTGCGGTTTCTCCTTCCCACAGCGACTGCCATCTTGACAGCATGGTATCACAAGCAAGAGAGACTCAGCCAATTCAATCTGCACCTCGACACGCAGTTAG
TCGAGCTGTCTCGAGAGGTCTCAGCACCGATCGGACGCGTGTGACGACAACTGGAGACCTAACGAGTTCAGCGTCGGCGCCGTGTCGTCAGTCCATTCGC
AAAAGTGCCACCGTTCGGATGCGAAGACGAATTGTACGACAATTTCTCGAGTGGAAGTCCGAGCACATGAAATTGGGGCGGTATTCTATTGAAAAGATGC
TTGCGTTCGAAGAGTACCAACGGGTTGCCAGTCGCACTCGAGTAGCTGCAGTTATCGTGCTGACACCACTACCAGGGTTGCTGATTATTTTATTGATGGC
GCGATACCTCTGAAGAGCCCTCTGCAGGGGGTAGTAGGAAATACCTCGTTTTTCATCCAGTCGTTTCTTGTACACATCGCGATGACCTTCAGCTTGCTGC
TGTTTATCCGTTGCTCACTCGGTCTATCTCTCGCGCTTTACTCACACCGACAGTCTGCATTCATTTCAGTCCTGGCGTCGGGGCTCAATGAGCTGCTCAT
GCTTGGAGTGGCATCGTTGTGGGAGTTTCCTATCCCATTTCGTGGCATCATCGGAGTTCCTCCGTTCTTGCTCCTGCTTGTGGGTTTGCATGGAGTGGTG
TTGCCCACTCTTATGAAAGAGCTTCGGATAGACAAGTGGAGATATCTCCAGCTCCTTTCAGCACAGGTATCGATCCTTGTGATTTTTCAAGGTGTTGCTG
TTCTGTTCATGCATTCCCCGGAGTGGGGGCAAGCTGCCATTACAGTAGGAATCCCTCTCCTGCGAATCATACTCAAGCGAATCATTTGGAGACTTTCCAG
CTGTCTTGAAGACATTAGTACAGATGTGGGTGTGTGCGTGATCGAGATTTTCGGGTCGCTCTTTCAGAATGTTTGCCTGCAAAATGCCCGCTCGCTCGGA
GTTTGTGCTTTAATCATCCTTGTCGACTTCACGCAAGCCATCATCGAGACCAGGTTGTACATGGAGCGTAAATTCGTGGTGGACGGACGACAAACGATAC
GCACTGCGGTTAAAATTCTGGAAGGAGCACTGCATTTCGGTGTCCTTAATGCAAAAAAGCCTACTCGATTAACTAGGCAGCGTCCAGATAGCACAGTTGT
GGGTGTTACACGAACAGGCAACTCCGTCAAGCTACCTTCCGTGGACTTATATAGGAAGCCGAAAAGGGTGTCGATAGACCACTCCCAAGCCAAGAACTTG
TCGAAAATTGCGGTAGTATTGGAAAGGGTGGTTAATGCCGACACTATCGATTTCGGCGAGTTCACATCAGGTACGAACGATACACGAGATGATGGCCATT
CAGCTGTCCGATCTACCACAGCATTTGGGCCAAAGCGCTCGACAATCATTGATGACGTGGAGATCTCACACCGATACCATGCCACGATATTGTCCCAGGC
GCTTCAGCTTGTGTTTGCCTCGGAGTGCTGATTTTTGCTGAGTACGCCGAGTTTACATGCTCCGTTCTCTATGGACTTTATACAGTGCTGATTTATCACT
TACCTTACGCCAAGTACAATTTCTTCTTCATCGGTCTTTCGCAGCATCAGTTTTATGCTTCAGTTGCCAACTCTTTCGCGTACGCTGTGTTTGAAGGGGC
CTCGATGGCGGCACTTTTTGTGCTCGTGCGATGGAAGTACGGGCTTTCTACATTTCATCAGCTAGCATTCATCTTGGAAAAATATTGGATGACTGTACAA
GGCAAAATGGTCGGAAGTCTCACACTCATATTCATTCTGAGCACTATTCATCAAGGTACGCTGTTTGCTATACTTCAAGTGGGTAGACTCGTTACTTGAC
GACTTCGTACATCAATTTTGCTGCCTGATAGGTATGGATCTATCCCTTACGTTCGATTGGGAGAAGGTTTTGAGCGCCACCGCAGAATAGCCACCTTTCT
AGTTTGCAAGGATCGAAAGCCATTGTGCAAATGAACGAGCAGCTGCAAGTCGCAAAATCGACAAGGAAAAAGAAAGAGATTAGTGTATTTCATTGTTTAT
GAATTGTATTTTGTCTGCTGGTAACGTGCGGTAGATTCTCCACTCGGATCCGACGTCGTCTAAATGGATACATCGGCATCGGTCAGACATCGTCCGAGTC
GGATTCGTTGAGAAAATGCTCATCATACATGTACTTTGGACGCCTATTCTCTTCTACATGTACTTCAAAAGTATTTAGGACGATGGTCTGTCCAGAAGAT
GCTCGCCTTCGAAGGATACCAGCAACTTGCAGGCCCTGGTCGAGCGTTCGTAGTCA