Description :
From Genome Similarity Track
Location :
Scaffold_1187:3487- 10156
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1187-fgenesh-gene-0.2Glycosyltransferase

Sequence
6669 bases(100 bases per row)
GACTTGGCGCGCGCGCGACTGAGGTTGCGGTTGCGCGCGGTGCCCGGTGTGCGCAACGTGTTGCGGCTGGCGGAGCGGTGACGCTGCGCCTTCTCGCGAT
CCACCTGGGCCTCGTGCTTGGTGCAGATCACGCCGTTCTTCTTCGTGCCGGCGCCCACGAGCAGCCCCATGGCCACGGCGCAGAAGCCCGCCAGCGCGTA
CAGGTACAAGTATCGGTTCTTCGTCATCGAGTCCGACGTCTGCATGTACACGTATCCCAGCGGCGCCACGAAGAAGAGCGCGAAGAGGAACGTTGTAGAC
ACAGCGCGGCCGCGCGTGTTGAACATACCGATGCACGCCGTCCACAGCGCCGCCGTCGTGCCCAGCCCCAGGAAGAAGTACATCAGCATGCAGATCATCG
AGTAGTACAATCCGGCGTTGTCCAGGTTGTTGAGAAAGCCCGAGTTCTCGTTGAACCCCAGTACGCCCGCGCAGAGCGCCACGGGGATAAGCGTACCGAA
GAGGATCGACTTGTGGTCCAGTTTGTCAATGAAGAAGAACGAGAGCAGCGAGCCCGTGAGCTGCAGCGCCACCGAGCTCACAAACATGCGCGGCTCGTCC
TTCAAGATCGTCGACGACGTCACCTCGGCCACCACGAACGCGTTCAGCACGCACGTGGACAGCGACGACACGAGCATGAGGAAAACACCGAGGAGGAACT
TGAACGCGTTGCCGCCGCCCTGGTCGTCGCCCGTCTCCTCCTCGCGGATGCTCTTGAGCTCGTCCGACACGTCGGGCTTGCGGCGCAAGATCACAAGGCA
TGCCTCGCACGCCTCCCAGCCCTTGCGCTCGAGGATCCAGTACGGGCTCTCGGGGAAGATGTTGACGGCCGGCGTGATGATTGCAATGATCACGGACGCG
CCAAAGGCCTGCCACACCCACCCGAGCTCGTTCACAGTCGAGAAGTACCCGTTCATCATCGTGCCCAGCACGAAACCCACACCCAATAGCAGCACTGACT
TGCCGCGCATGTCCTTCGTCGAGATCTCAAAAATGTACACCGCCAGCGACGGCAGCAGAATGCCCACCGAGCAGCCGAGCAAACCGATACCCGGCAGCAG
CATCGTCTTGCGTAGGTCGCCGTCGGCGCACACTGCGACCATACCCAGCGTGCTGAAGAGGCCGCCCGTGACGATCGCCAGGCGGCGGCCGATGAAGTAT
GTCAGGAAGCCCGACATAATCGTACCCAAAACGCACGCACCATACATCAGGAACGTGATCTTGCCGTCGCCGAGGTCGCCACTGAGGATGTTCTCGTAGG
ACGCCACGTAACTCGAGAAGCTCGCAGACTGCTCCAGCGTCGAGAGCAAACTGAATAGCCAACCGCAGCCGGCGCCGCCGAGAATGCCCATGAAAGTCGC
CAGCGAGAACGCGTACTGCGATGACGCGGACATCACCTTAGAAAAACCCTCGTTGTACATCATACGCGTCTGGATCACGTTCAGGAACGGGATGCACGAC
ATGATAAACAGTGGGATGATCATCGCCGTGCAGAACAGGAAGTCGAACAGGAACTGCAGCTGCTGGAACACCACGATGCTCGCGATCGACGAATTCGGGA
AGCTCCACATGCGCATCACTTCGTTGATACCGTAGAGCCCTGCCGCGTAGCCGAAGAAGAGAGAGATCGAGTACTTGAAATCCTTGTCGAAGACGATCCA
CATGGCCAGGAAGTACGCCGTTACAACAGCCAGTACACACGTCAGGTAAATCCCCGCACGGATCAACGGACGAACGGATTTCATGCCGAGACCAATTCCG
TGTACGAAGCCCAGCAGCACAACCGTCGCCAGCGCAGCACCAAACACAAAAGCGACGTATTTCACGTCCGAGGTCTTCATCGTCGACACGTAGAACATCA
AAATGAAGTGTCGACTCTCGCGAAGCAGCACCGTCACTCGGGAGATCATGTTGGAGCTGTGGAGCTGCTTGAGATCTCCCTTCCACCACGTTACCCATCC
GCCGGTGTTCACTGGGTCATCGTCCTTGTAGTCCTCGCCGACGAACATCCAGTTCGCCCAGGCAGCAATGTCCACCTTCGTCTTCTCCCAATCCAAGCCG
TCCGTGTTGAACATGAACGGCCCGACGATCCAAAGAATCGAAATGAACCAGATCGAGAACGTCTGCACGCCGTATCCTTGAGCTGTCTTGCGGAACTCGA
ACGCAAACATATCGTCTCCGATAGGCGCATCTGTTTGCCCGATGAAGAAGTTGCCGAACACTAAGTAGACCATACAGAGGCCCACCAGCTCGAACGCTTT
CCGATAATGGGAGCTTGCGTATGCTTTGTATAACAGCACCAGCGTCTCTCGCGTAATCTTGAAACCACGACCTGTCGCTTGGTACTTGGCGCCACCGTGC
AGGATGTTGTTGTCGAAGTAGTGCATCGTCGTACCCACTTGGAAGACGAAGAAGGCTGGTCCAAGCGTGATGATCATCTCGATGAAGCGGTACATACCGC
GGACCAATCCACCTTCACCGAAGTACACGCACATCAGCGGAAGCATGAGGAAGGTACCGGCTTGGATGTAAAACTGGGTGTTCACCACCGCCTTCAAATC
CGTGAGCACGCGCGCGTCGAATCCTCCAGCAACGTTGCCCTTGATGAGCGCAGTCGAGTTCATGCTAAAGATGATCTCCGACTGAACACCGGACAGCGCC
ATGTACACTTTGCAGTACATGTACACGAACGCAGTCACAATCGTCATCCACGTCGCGTAATAGAAGCCCGTGTGCGAGTAGAACATCGAGTTCAGACGGA
AGAAGTCCAAGAACTGCCCCATGCGATGAGCTTCGCGTGCGAGCGAGGTTTCACCGGCACCGTTTGCCAGCTTTGCTTCGAACATCGAAATCTGCGACAG
AGCCACATCACGACCCTTGCCGCACTGCATGAACTCCACGTGCGTGACAACGCCTCCGCGAAGAGTCGAGTTGAAACCAGCGAACACATCCTCCGACAAG
TTGATACTCTTGCTTGCCTTGGACACACCACCGCGGGAAAGTGCGATAACCTTGTCGAAAATATCTGGGTGACCGTAGTGCATGCGCACGTAGAGAGGAT
CAGCGAGCACACGCTGCGACAGCGTCACGAACACCAGCTCTTGCCAGGACTTGAACTTCGACAAAGACGACGCGTTACCCGTGAAGATATGCTCACGCAT
GCCGATGATGGAGACGGGCTTCTTCGACGGATGCTGCTCGGCGGTCACAAGCAGCTGTGGCATCTTGAGACACTCCTCGAAGTAATGCTGCTGGTTCATA
TCGATGGTCTGCAAGAACTCGCCACGGGTAAATTGCAGCGCGTTGTTCTGGTTCTCCGGTTTGCCTTCACCAATGATCGGATCACCAGGAAGCTCGTAGC
GATACACCTCCGCGATTTCCTCGTTCTCGCTCTTGATTAGCACAGTGTCGTACCGCTTTCCGCCATCTTGTTCAATCGTGTCCACGTACGCAACTCGAAG
GTTCGGGTAGGTTTTGAGGAGGTAGTCGATGTCATCAGCCTGTGTCTTGCCTTCAGCTCGGTGCTTACCGTACACTTGACACGCACAAATGTACGAGAAC
TTGAGGCGCACCATGTCTTCAAGCTGGGCTTGCTTCTGCTCGGCCGTCTTGCCGGGGCTCGAGCCGATCTCCAGCCAGTGAAGAATCTTGATAGCGTCCT
CGTACAGCATCATACCCTGGACAGTGCGAGCAAGTGTCTGACCACGGTACGAAGCCCACAGACGGATCTCCATCGGGTAGTTCGCTTGCGCCTCCTCGAC
AGTGGTCACGTCGACACGCTCCAAGAAGTTCTCCCACTCTTCTGGATGGATCGTGATCAGATACTTCAGAATGGTGATGTTCTTGCCATTTTCTTCGACC
TTGTTGAAAATCGGGTGGTTCGCCAACGGGTTGTTCAGCTCGTCCAGCGAGTTCAGCACACTTTCACTGTAGAACGGGGTCACAACAGAGAACGAGCGCA
TCTCCTTGATCGCCTGCAGCTGCGGAATGTCCATCACCAGAGACTTCATGAAGAAGCCGAGACGACGCTGCGCTTCTGGAACCCGTGGCATCGCATCATT
TCTCTCGAGAGACATCAGCAGGTACGCGCGAGTCGCAGCACCCATCGCGGTGTCGTTATGGAACAGGTTCACGAGTCCGCGCGACGCATACACGTAGCCA
TTCGCGCTTGAGCAGAACTTCGAGTTGCCAAACTTCGAAGCGAGCTCCGGACGGTTGGCGAAGATTCGGATCGCGTTCAGCAGGTTCTCCATCTTCGTGA
CAAAGTTGCGGACCACACCCATGGTGTGAACCCTGGACGATCGCAGATGGGACGATTGCGTCTCAGGGTCAGGAAGATCCATCACGGCTTCCAAAAACTC
CATAGTGACTAAGCGAAGCTGCGTCAAACTCTTGGCGTCGAACGTCTTCATGAAGTTCCCGCCGCTGGCGATATCTTCAATCGTGCGAAGGGCATCCAGC
ACATCGGCGTCGTCGCTTCCGAGCAGGGCCTCCATCACGTACATGCACGCAGTGAAGAAGCTTCTGACAGCCGACAAGCAGTCCTTCTTCATCATGTAGG
CTTGCAGCGTCGAGTCGCCTTTGCCTTCCTTCGCAAGACGCGAGGTGTACTCGAGCGCCTCTGCCAACTTGCCCGCAGACAAAAAGACAGGCTCGAAAAC
TTCGCCGGAGCTTTGGATATCGTACTGCAGAATTGCAGCTTCTTTGTCATCGACCAAATCGCCTTCGCGGAAAGAGTTAACGATCTCGTTCCAGACAACA
ACGAAGCGCAGCATCATCTGAGACTGGTAGGCAGCAGCAGAGTTGTCGCTGGCAGCGTCATTCGAGCGGGCGAGCGACGTGACAACCTTCTGGTCGAAGA
GGCGTGGAGCCACACGGAACGCCTTGGTGATTTCGCGAATGCCATGGATTTCGCCAGTCTTCATCAACAGACCCTGGAATCCTCCGAGGAGCGCTTGGAA
CACCGTGAAGTAGATCTGCGTGTCGTAGTTGAAGATGAACAAGACGGGCATCCACAACGCCGTGATGTACGCGAGGTTGTGGAACGACACGACGTTGCTG
CTGTACTTCAGCGACATCGAGTAGATCGCCAGCGACGGGAGCATCAGTGGACGGACCAGGATGAAGTAAGAGACGAACGCCTTCAGCGCCCACAAGATCA
ACCAGAAGGTGATGTACTTGACTTGGTAGCTGAAAGGTGGAGCCATGTTTCGGCCAACATAGCAGCTCTCTCCTTCACGGATGAACTTGGCCACGGAGGT
CTTCGTGACGAGGTGGGGCACAAACGCATGCGCAAGCAGAACGATAGCTCCTGGAGTGACAAAAGCCATCGCCGCAACCTGAGCCTTTTCCAGCAGCTCG
GTGTCTTTCTCGTACTTCAGCGGCTCGTATATCATCCATCCGAACAGGCCGGCGAACAGACCGTTCCACAGCAAACGGATCGCCAGCGCGCCGCCGTAGG
TCAAAGACCGCGATGACGTCTCGGTTGATTCACGCGCGACCAGAAGGTGCCAGCCATGGGCAGCCTCGAGCATGCACTTGAACGCAGCCATCGTCGCGTG
CGAGAAGACCAGCGAAATCAGCGCGAGCTTCAGATCTCTCTTGGTGTATGGAGCGACGACCTCGCCGAGCGTTTCGAACTGGGAGAACCAGAGCTTGCCG
CCACTAGGGGAAATCGATGATGCAAAGCTGAGCACGACCAGGACGATGAAGAACATCATGTTGAACTGGAAGATGCGGAAGTAGTTGACGATCAGCGTGA
AGATACTGCGGTGCTCGTAGTACGTCTTGCCGTGGTTCTTCGCGAGCTCCTCGCCGATCTTGGTCACGTCAATGTTGAGGCAGTACTTTTTCCAAAAGTA
CTCGTTGATGTCGTCGTAGTTGCGCACCTGCGTGTGCTCCAAGTGGTTTCCCAGGCTGTTCTTGCGCTGCATGTTGCTGCACTCCTTCCACACTGGGCGG
ACGACCTGGCGGAGGTACCAGCCTTCGCTCACTCGATCCTGTCCGAGTGGGTCCTTGTCGAGCATCGTGAGCATCTGGTGGTAGAGGTAGCAGAGCGACT
CGGGCATATGACGCAGGTTGCCGGCTTCGCCCCAGATGAGAAGGTACAGCATGATCTCCATGTGCAGCGTGTTCTTGAGATTCCCCTGGACCGGTCCCTG
GTACGCCTGCTTCTTGATGCCGAGGAACTCGCACCACTCAAAGTAGTTGGACGCGAGCTTCTTGTGGAGCGTCTCGACGTGCTGACCGGGGCGGTCGGCC
TGCTTGGCGCGCGCCTTTCCGTTCGCGAGCAGCAGGAGCACGTGTTCGCGCTGGTTGTCAATCGACCCGGCCTGGAAGCCGAATTTGTTGAAGAGCACCT
CGCAGCAGTAGTCGATCGAGACCTCATCGTCAAAGTCGCCCTGGAGGCCGCCGCCGAGCTTGGCATTGGGCTGCGCGTGCTGCTGCGCGTGTTGCTGGTT
GGGGATCACGTCCATCATGGAGAGACGGCTGGAGAAGGTCTCGCGCGGGTCGCCACCGCCGCCGCCGGGGGTCGCATGCGGGTGGCGCGTCGAGTTGTTG
CGCTTGCGGTCGGCGTCCAGCTGGAAGTAGTTGGAGCCCGCGCGCCGGCGCTCCTTGCTCGCCGCCGAG