Description :
From Genome Similarity Track
Location :
Scaffold_103:3487- 7330
Transcript NameFunction/comments
Phyta_totarag3620hypothetical protein

Sequence
3843 bases(100 bases per row)
gttgctgctgaagtagGAGTTGCATTCGAGACCGctgttcttgctggtggTAGAAGTAATTGTAGTTGAGCTGGGTCACAATTTCGTTCACGTGAGGCGA
CGCGCCGTGTTTCTGCATGGCTGTCAGCATAACTACCAGGAAATGCGATTGTCGTTTAAACTCCTTCGAACTTCTTGTCATTTCAGAGCGAATGATGCGA
AAGTCGGGGTGTTCCAACAGTCGGACACTGAGCACCTTGCTGATGCATTTCTCAGTTTCGTGTTCGGACTCATCCTCATCTTCACTCCAGTACTCGGGGA
AATATGTGTGCTTGTTCCGGTCTACCGCGCTGACGAACTCGTCAACTTGACCAACAAAGCGCAAGATGTGGTTGAAGGTCGTCAGGAGGTACTGGATCAC
AGTCGCGTGCTACAAACAAAAATATAGACCATGTCAATACACTTTTAACAGTACAGATCTATCAAACAGTTTACCTTATCCAGCAGAAAGAAACGGTTTA
GTAAGTGGTCCAGATACTGCTCGTGCGTAGCATCCATCTTAGTAGTATGCAAACAATGAACACATACCAAAACGTTTAGAGAACGGCTTTATGGCAACAA
AAAATTAAAGTGCATTCCGTACCTCTGCCAAGCTTCGTGACGATTGCAGGATCTGGCGATACTTGGACCACCCTTCACTTGATATCTGGCACACCACAGA
TTGTAAATACAACCGAACTCGTGAATTTGCCACAGAACCTTTTCGTACCTGATTCGTAAGATAGCTCAGCAAACTCTTCGTGTAATGCAGCATATCAGCA
ATTTGAATGAGTACTTGACGCATGTCTTCCTCGATACTAAACGAAACCATGGAATCTTAAGAAGTCAGAAGCAAGACAAACAGCCAATGTGGAGCTAGCA
AACACATACACTGAATAGCAACGACGATGCCGAAGGATCGACTTGAACTGCATATGAGAAGCGCAGTTGACACAAGTTAGCAAGCGCAGAGATTTAGGTA
GACCATGAGGGGTGATTTGGAATTCCATACCTTGACCAGGGCCGACACCACAGCCTTCACCTGAACCAGGAACACTCCGAGTCTTGAGTACTTATGCATG
ATCGATGTGCTGAAAAGCACGCGAAGTGGTTGTTGCGCAGAAAACGTGAAGTGTAGGCACTTCATAGTCGCAATATCGATCCTTGCGCCACTGGCAGTGC
TATCTAGCAGGCTGAAGTCGACATGAACGCATAACCGACCACCAATTTGCCGCTGcgaagatgacagcgagTTGTCTTCGAACACTCCTTGAACTGCACT
CTGATGAAACGAGTTAATCGTCTCACTGTCAGCCCACGCGACGGGATTCTCTTGCATGTGAATCACCATTCTTTCACTGAAAACTTTAAAAACGTCTTGC
TGCAGTCCGCGTAACATCAAACATGTAAGAATCAACCAACAATAGTCCACTACAGCCGTCATATATGTAATCTGCTTACCTGTGCCATGAGCACGAACAT
CCGAAGAGCTTCCACGTGTTCCATATAATTCATTTTATCTCGAAATATGTCCGTGATCTCTCCATTTTGTTCACGACACTGCACAGCATAATAAATGAAC
AAGTGTTAGTACGTCACTGGTACAAAAAGGATAACCAACTGATGATGCACCTTGATCTCGAGGTGTCTAGTGAGACATCGTTCCAAAATCCTGTTAAATG
GTACGCACTCCAGCATTCCTTGTTGCACGGGAGGTGGGTCTTCTTCATTGCCTTGTGTTAAAGCTGTAGTCATCGAGAAAATACCTCCGTTACGTCTGCA
CCCCATCGTCTCGAGTTCACTTGTTAGTGACTCGTGCAAAGAGGGCTGAGGTTGCTCTGGTTTCGTCAAAGGTTCTTCTACCGTATACTTCTGGTGCTGT
AAAAAGCGATTCTTCATTTGTCGACTTGCCAATGCCTCGTTCATCAAGTCAATCATTGATTCAAAGAACGTCGGGACGAGCGACCGACTTACTTCGAACG
GAGCCAGAGTCAGTAGACCTTCTCGAAAACTTAGACTTCGTCCGCGTATTGGAGTAGCACTAACGCTCATTGACGCAGGCGTAGCGAAAAACAACTCGCC
ATCCAGAGGAATCGTCTCAAAATGCCCCACTTCAAAGACCATCCGGTTAATCAGATTCAAGTACGGATTCAGCGCCCCAATAAAtaggtgcagcagcaca
tcgGACCGTGATAATCTGCCTGCAACGCTTGAATTTTCATCGGCTGCCACACTTTCGATATAGTCCACCTCCATCATGTGGTACAATGAATCAAGCACGC
ATTTCGCTTGCTCGGCGCGCTTAACTTCGTGCCAATGTCGACCCGACAAACCCTGAAAGCATTCCACCAATACCCCCTTCAACCACGAAACCATCTTGAA
AATCTCCTTCAGGCCACCATAAATCCCAAGCAAGGTAGACTGTCGTGTATTAATTCCAGACCATGGACAAGGGTCCTCTCCCTGTAATCCGGTTATGGCA
TGGGTCTGTTGCTCTACGTTGCGTATTGATTCACTCAAGTTTCCCATAACCCCCGAAAGAGAATTAGCCAGGCCCTCCAACGTCACACATCGGTGTTGCT
CACTGAAATCTCGCGCTTGACGAATAAATCCACGAAAATCTcgaagcaactgcaactcTGACGCTGCTTGTGCGAAATCATCCAGTAAATGCTGAAGCGC
CAAGGGAGAAAGATGTCCGATCGCCACACTTCGTGATCGTCGAGATCGTTCGACCATCTTGGTCTGAAAATCCACACTGAAGATCGAGGGTGTAGGTCTG
ACTGGGCGGAATTCAAACAAAAGCGAATCAACCCcgtccagcgcctcgaaCACCATATTCACGACAGTTTCTTCGTGGATCAGTCTACGAGGGATAATCt
cattcgttgtcgacgtgTTTTCTGCACTTTTAACCACAGCTTCACACAGTAACCATGGTCTCTCCAACGTAAACGGAACAAGCGCTTTCTTGTCCAACTG
ACACGTCGGGTCATCTGCAACGTCAACCACCATATCCTGCAACGTAACTTCAGGATAATAACGACATAGAATTTCGTCCTGCATCGTCACTTCTTCCGAA
AAATCctgccgtcttcttctctccatctcctgtcgacgtgcagcttcagcttgctcAGTACTCTTCGTTATGTCACTAACCAGTACACTGCTCACTCGAG
AGTccagcgacgtcatcacCTCCTGTTCTCCAGTACCTCCTTCCTCATCTAAAGCTTCACTCGACCTCTTAGCGTTGCGTTGGCGGGCTCTGCCAACACG
GTGTTCACTCTCCACTGCACTTTCATCTGCGCTGCTCATCTCCCAGTCGCTttcgtcctcgtcactgtcgtccCAGGCCTGATACCACTCGTCATTGGTG
GAGATTTGGAACAACTCCTCCACTAGTTGGTCCTGCATCATCTTCTGTTGTTTCTGTCtgtgctgctcctgctgtaGCACCGTCTTCCACCTGCTGTGCG
AGTCCAGATCCACCGCCACCTCTTCGTCCGTTGCGGTCGTTGGCGAcgtcgccagctccagcagaagcttcagAACTTGGTACTCGCATTGCGGAGCCAA
TTGCAACAGTTTGGTGGCTCGATCGTCCTGTGAATGGACGCGGAACTTGGTTGCAAGAGCTTCCGTTTGAGTGTGGACGTCCTGCGGCACACAATCCACG
AACCGATGCGAGTACAGCTGCCCCACGACGCGGTCAGCACGCAGTAATAGTGCCTCCTGGGAGATTGGAGGGttggcttcttcatcggcCTGGTTATTGT
CGCTGAGATGCGCGCAGAGCTGCTTGGCAAGAGGCCGCCACTC