Description :
From Genome Similarity Track
Location :
Scaffold_22:348610- 350849
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_06514conserved unknown protein

Sequence
2239 bases(100 bases per row)
CGTTCGAAATGCGCTCAAAAGCGGTCGTCTGCCCACGGTAAAGTACCTCCGCTCGCTCGGGTACTGTACCCGTTTCCGACCACAGTATTCTTTTCCGTCG
TCAGCCGTGGTGCAAGCCCGAAATAGTTGGTGTCCGTCGGCTCCTTGTCACCCACGGCTCGCCTTGGGACGAAGACGGAATGATGCCGCAAGCCTGCGCT
TTCAACAGCGTACCGATTGTCGAACTCATGTTTCAAGGAAAAGAGGCTATCCCAACGATGAAGCTTACACCCACTGTGGCAGTGCAAGCGACAATATGCT
GCTGCAGACTGGCGAGGTTCACGACTGGGCGCTTGTTGTTGGGCATCGGATTGCTGCCGACGCGGCGGCCAACGCGACGGGCGAGAGGCAAAATGGACTG
CCTTGACCTTCCACAGTGAGCTCCAGGCGCAGCTTGTCTCCAGAAAACCCACGCGCACGACCTAAAATCCAACGCACGATAAAACCATCGACAGCAAATA
CAGTCTTGGACACTCGTGTGACGTGGCAGTGGTAAATGGATTTCATGACATCCGGATATACACAATCGCTCGTGTGATTGTCCGGATATTGCGTCCGACT
TGCATTTGCAAAAGAGCGTCATGGCCGCCACGTTCCACCACGTCGTGCTCCACCAGCCTTCGATCGCATCGATGGTGTTTGAGTTTCATTTTGGGCTGTA
TGAAGATGTGCGTTCAGCCGTCCGCGCCTGCAAGCAGCTCGTCGCATTGGACGCCGCGCGAGGCGTGTACACGTGCGACGCATCGTTCCCGACGGCGTTT
GCGCTCAACGTCGTCTGGGACGGTCCCATGCATTTTCGCGCGTCCTCGCATAGTCTCCGCAGTGGGAAGCGCGATGACCGCTTGCCGCTGCACTTGGCCA
TTGCCGAAGGCTTTATGCAGCTGACCCAGCGCATGCTACGCTGCCGACCGGACCTCGCTTATGAAGACGCCATTCTCTTGGCCTTTTACAAGAATCGCCT
CGAGACTGTCGAGCTTCTACTGGAGCTGCGATCGAGTGTGCCAGAGCTCTATCGACGCTTCGACGCTGGATCCCCACGTACGATACTCGTATGCTCCGAT
ATTCTTGGAGAGTTGAGCCATGACGTAGCGGGTTACGCGCGACGTCCCAATTTTATCGTGCGGTCCATCTTGCCCGCTATGCTAGCCCGAGAAGACTCCA
AAGGCGTCGAGCTGCTCCAACGATTTGACTCGCGCCCCGATATCTTTGCACTGGAGATCGTCCGCGACGCCATTCTGAGCGCGACGCTGGACAACTTGAC
GCTCGCCGTCAACACATTTTCGCGGCTTGTGTACCCTGGTCTCTTGGACGATATTGCGGGTCGAGGTTTCTTGCCGCTCGTGCGAACGCTGCACGAACGC
GGCTGCAGCTGCTCAGAAAGAGCCATGGATTACGCTGCTGCGAACGGTCATTTGGAGGTCGTCCAGTTCCTCCATTTCAACAGGACGGAAGGCTGCACAA
CGTATGCGCTCGACCGTGCCATTTACAATGGCCATTTCGACGTTGTCTGCTTCCTTATTGAGCATCGAATGGAAGGCGCGTCGCCCAACATCCTCGACCG
TGCTGCTGCCGACAGCCGCATTGATATCGACCAGTACCTCCATCTCAGGACTTGGATCCTGGCACGCCACTGCTAAGTCTGGATAGCTGTGCTACGATCG
TAGTTCGACCCTGGATTATCCAGTCTTGGTGTTTACTCAATACACACATTACATTTAGCTCCTTACGACACAAGTCGCTGCCTCGTGCGCCAGCACATTT
CTAGACCACAGAACGCGCTTCAGGGTTTTTTCTGTCTCGAACGACGACCTCGCACCGCTGGCCGCCAAGCGCTGGCTCAGTACACTCGACGGCGGCGCAA
CCGCGGTCGTTACTGCCCGCCGCGCCGCCGGTGCTTTGATTGCTCAGGAGAGACGTCAGTCTGAAAGCTACTTTTCGACAAGACATCGGCGCAGGTACGG
GCGTATGCCCTTGTACTAGTACTACCACGAGTCGAGCTACCACACGTCGTGAACTTGCCCTTGTCATCGTGGTCCTGTGAATACCTAATGCTTCGTATCG
ATCTACACATTTTGTACATCGCTGCCAAGTGGCCCTGGTTGATGAAGATATTGGTCGGCACGTGGTGTCGTTTTGGCTCCGCGGTCATGTCCAGCGATGT
ACGTTTAAGTGCTGTGTGTTGTGTGTTGAGGTAGCAGCT