Description :
From Genome Similarity Track
Location :
Scaffold_30:348541- 351123
Transcript NameFunction/comments
Sapdi_VS20SDRG_09480hypothetical protein
Sapdi_VS20SDRG_09481hypothetical protein

Sequence
2582 bases(100 bases per row)
GATCTTACTCGGTCTTACTCGATTCGATTCAATGACGCATCACGCGCCTCAACAGGCAGAGCGCTGTGTTCCAAGGTACATGGATGTCATAATAGCAACG
ACCAACGTTGGCTCACGGTCAACTCGAGAGAACTGCCGAACCTTGGGTCCGTTGCCAGGGAGGATGTCCACGATCGAGCTACTTTTGCACGGCTTCCCTC
GAGCCATAGATACTGGAAGAAGCGCGTTTTCGGGTTGGAGCATGGCAATGGCGGAACATAATTCGGCGATCTTTGCAGCTACTCGACTCGATGGAAACAA
CCATGGAACCGGTTGGCGATCTTGAACCGACGCGGACCAATCGCAGCGCGCGCTTTTGGAACGTGGCCAATCACAATCCACCGTGCGGTACGATGTGCAC
AGCAACCTCGCCTCTACAACAGCGCAGTTGGGCAAACGCCATGCAAGAAGACTCGCCGCTGCTTCCGTCCTCCCGGATCCTCGACATCCGTGGCGCGGCG
CCGCCGCGGTCCGGCCTCCGCCACCGGCAGCAGCCCTTTAGCCGCGTCAAACCAACGCCGGGCCCGCTCCCGCCCGTGAGCTACCGCGCGATCGTGTGGC
ATGTGCTGCACTATCGGTCGTCGATCCAGCACGTGACGTACATCCAGCAGTGCTCGTACTACGTCGAGCTCTTCCTCCTCAACCTCATCTTGCTCAACGT
CGTCGTGACGATTCTGAGCTCGTCGAGCCTCGTGGACCCGGCCATGCCAGGTACACAACCATCGCCTCCAATGTGCCATCACAAACGAGACCGTAGTACA
CACGCCCTTGTGGTTCAGAGGTATCGTGTACGTCTCGACCGCTATCTTTACTGTCGAGTACCTCTTGCGCTGGTGGTCGTGCGTCGAAGACCCGCGCTTC
AAGTTTCACGTCGTCTTTGGCCGGTATGCACTGACTGTCTTTGACATGCATTTTGCCAAGTCGGATGACGATGTAGGTTTCAATGGATGCTGCGGCCCAT
GTCCCTCATCGATCTCATCGCGCTCGTGCCCTATTTTTTGGAAATTGCGCTCTGCTCGGCGACCGCGTCCGTCTTGAGGTGACGGCAGGCACATTTTTCT
CACATTGGCTGCTAGGACGTCGGTGGCGTATCGCGGCTCGATGACCATCCGCGGCCTCCGGCTCCTCCGCGTTATTTCCTTCCTGCGCATTGAACGGTCG
TACGATGCTATCAAGCGGCTGCGCATCATCTTTCGGCGAAAACGGGTAGGCCGATCATGCTGCATCACCAAGTCCTTACGCGTGTGCAGCAAGAATTCTT
TGTAGTCACCTACCTCACAGCGGTCGTCATCCTCGTCTCGGCCACCATCATGTACGACAACTATTCTTGAAATTGCTGATCGACTCCTTGTTTTTGCTAC
AGCTTTTTTCTCGAGTTTCCCGCGCAGCCCGACGTCTTCTCCAGCATTGGTGTCGGCGCATGGTGGGCGATCGAGACCATCACGTCGCTCGGGTACGGCG
ATACGGTGCCCATCACGGTTGCCGGCCGCACGTTCGCGTCGGTCGTCGCGCTCTGGGGTATCATCCTCTTTGCAATCCCAGGTAGACGAATTAACATTGA
CACGCGTTCGGTACACGCTGGCGCAGGCGCGATCCTCGGCAGTGGCTTCATTGAGGTCATGCTCGAGCACCAAACGGCCAAGGAAATGCGCGCGAAAGAC
CGGTGGATCCACGAAATCTCTTCGCAGCTCCACCACATTCAGTCGGTCGCCGCGGGCTCGCTCTTGGCGCCTCGTACGTTGTGACGAGTTAAGTCTCCTC
GATCTGATTGCATGTCCTAGTGACGTCCTTGTCCAACGTCCTCTCCGAGCCAGTGGAAGCCAGCCCCGACGAGGATATCTCCGAGGCTCCGATGCCGGCG
ACACCACCACTGTCCATGCCCCTGGGCACCCCGGATGCGGCGACGTCGCCGCATTTGTCGCCGTTTGGGTCGGACGTCGTGACGGTCTCGTCAACACAGC
TCAACGAGCTGCTTCAAAACCAGGCATTGGCCAACATTGTCCGTCTGAACGGCGCACTCATATTGACACTAGGAAATGCTGTCGCTTCAGATCCAACTAC
AGCGCGAACAACTCGACCGCGTCTTGAAACTTCTCGAGACCAACACTCGAATTCATCCCAGCAGCAGCGTGTTTTGATAAGCACTGCACGTCAAGATGAT
TGGCGGTCACTGTACCATTTTCATGGGCAGCGAAGAGACCGCAACACAGTGTTTGCAACGCGAGAAAGATGTGCAAGCCCAATGAAATGCAGGTTGTATC
CAGGTGCACAAGGGCAGTGGACCAACCGCAGCGTACGGTGTTGATGCAGCGTAGACGCTCGCGGTGGGAGTTGACCATAAATACAGATCCCACGTGGTGT
CGCGGTTCCTTGGACGTCTAGAAAGGTTCCGTCCCCGCCCCCGCCGGCTTTCGAATTCTAGACTTCTATCGTCGCGGCAGATCACTGTACTCAACAAGCG
ATGACCTCCAACAAGACACTCTATCGTTTACCATCCCATACTGCGCTTGCATGCGCCTTGATCGTGCTTCAGAAACCATCCA