Description :
From Genome Similarity Track
Location :
Scaffold_48:348533- 352480
Transcript NameFunction/comments
Hyaar_Emoy2806321hypothetical protein

Sequence
3947 bases(100 bases per row)
ATGTCCTGATCAATGACGGATCAAGAATAGGCACTTACCAACTTGATCTGATCGCGCTGTGTCTTGGACAGCAAATTCGGAAATGGGCGGCACTGGAGGG
AGCGCTGGCTGTGGGGGGGTCTGTCCGTCTGCGGTCGAAAGTGAGGGAAAAACCTCGATTGCTAAGCTGCGAATGAACTTGCCATGCACATCGATCACTC
AATTTCCCACGCTCGAACAGAAGAGGTTATTGCGTGATCTGCGTAGTGGCAAAGTCAAGCAGATTTGCGTACTCGCCGCGGAAGACGAGTACGTAACCGA
TATTCGGTCGGCAATGGTATTCGCTGAGAACGAAAGGGTTCTCAGCAGCTCATCAATGGACGAGATTGGCATTTATGAGAAGACTCGGATTGAGCGATAT
ACATCCCAATAGTGGGAATCGCTCAAGACAAATCCTCTCTACGATGATTTGACGGAATATAGAGATGTGTTCCCAGAAACAATGCCGTGCGAGAGACCCA
ATGAAAAGGGTACTCGTCATGAGATCGACCTGAAACCAGGTTCAAAGTACTGTGTCATGAGCAATGGCCACTGTCTCATGAACAGCTACTAGTGATTGAC
AAATTCTTTGCCGATCGCTTGGCAGCGGGCCATGTGAGGGAATCTACTTCCCTACATAGCTCTCCGACCTTCTGTGTACGAAAGGCTACAGGAGGATGGC
GGATAGTACATGCCTTCAACAATTTGGATGCTGCCACTGTACCGGCTCAAACGCCGATACCCAGAAAGGATTTCATTATAGATGGTATTTCAAGGAGTAC
CATCTTTTCATCGATGGATCTGATGGACGGGTTCTATCAGATCCTTATGCGTGAAAAGGACATTCCTTATACAGCAGTGAGCATCCCAAGCGGTATGCTT
TGGGAGTGGATAGTAATGCCACAAAGGCTGAGTAATTCCCCTGCTACGTTCAACAGATGTGTTACGAATCTGTTAAGATCTGTGCGATAGTTCGCACCCA
GCTATTTCGATGACGTGTTCGTCCATAGCCGGGCTATGGATGGATAGATGGATGTGAAATTGCACCGACTCCACGTCTGGAAAGTTCTTACACTAATACG
CAAGCATCAGCTGTACTCCAACCTCAAGAAGTGTGTATTTGCTGCTAGCGAAATACCACTTCTTGGTTGCATCATGGGTAAGCACGACGTCCGGCCCGAT
CCTGATAAGATCAAGGCGATCACCGACTGGTCGGTGCTTGCATAAATCAAGAGAATTCGAAAGCTCCTTGGCCTAGCGGCGTATTTGCATAAATATTCAC
GCAATTACGCCGAGATTACTGTTCGTCTCTCTCGTTTATTGAAAAAGAACGAGAACTGGGAATGGAGTGCCGATTGTCAGCGCTCTTTCGATGGTATCAA
GCAAAGCTTGAATCGATCGCCAGTTTTAGAAATTTCAGACCGATACAGGCCATTCCACATGGTTTGTGATGCCAGCGACTTTGCAATCGGCTGTGCATTA
ATGAAGTAGGATGCAGACGATGAGGAACGTGTCGTCTGTTATCAGTCACGCCAGCTGCAACCACATGAACGGAACTACCCCGTCCATGACAAGGAATTCC
TTGCCATGGAGTACGCGCTGGCTAACTTCAGAGTCTATCTGCTAGGCGACAGACCCTTCATCGTTTATTCCTACCATGCGTCTTTACGCACGGCCGTAAA
CAGTCCACACCTTTCGCAGCGGATGGCGAGGTGGCTGTCATTCTTTGCGGAGAACCACGTCTCCATCGAGTACAAACCAGAACGAATTAACGTTGTCGCT
GACACACTCTCGCACCGGTTCGATATCGAGAAGGCTGCGCCACCCGACACTGGTCCGACCACTGTCGTGGTACTGACTTCAAGTGTCCCGTCAACCTTAT
TGAAAGACATACGAGAGGCGTATGATCCGGGAATGGTGCAATTGATTCAACATCTCTCGCACTCATCCGGGAAGAGCCTCAAACAGTTATCGTCATTATA
TTTATCCTCTAAGGCTAGATATAAAGTTCGCAACGGCTTACTCCAGTATTCGGCTGTTGGCGACACGCCTCGTGTCGTCGTACCAGATCATAGTGATCTG
CGATTGCGAATCATGTATGAGTACCACGACGCGCCTGTTGGTGGACATCGTTGTCGTTAGAAGACATATCTCATGGTGAGCCGCGACTTTTAATGGCCCC
GCCAGTATCAGTCGTGCGTAAGTACGTTCGGGCCTGTGAGGTCTGTCAACGGATGAAGCATGGTCATTACCTTCGTGCCCCATTGCAGCCTATGCCCGCC
CCGGCAGAGTGATGGTACTCTGTCTCAATGGACTTCGTCTTCGACTTCCCCGCTGACTCACGCAAGAATACTGGTAACTTTGTGTTCGTTGACAGATTTA
TCAAGATATTAATTCCGGTTCCTGTACCTTAATCAATCAACGCATCGGCTTGAGCTCATGTCTATATTGACTCGTTCTTTCGCCTTCACGGAATACCTCG
TGAACTCGCGTCCGACCTAAACCCGCGGTTCACAGCCGAGTTCTGGCATTCCGTGTTCAAAACATCCGGAACGCTCTTAAAGATGTCCACATCTGACAAA
AACAGATGGTTATAGCCAGATGCAACGCTTTAATCTTGTCCTTGAAGAGATTCTTTGAGGGCGCGTCCAATCTTTAACGAATCATAGGTAATTCTTGCCG
ATGGTGAAATTTGCCATCAACAACTGGGTGCACGCGTTGATGACCCACGCGCCGTTCTTCTGAATGGCTTACGCTATCCACGTCTACCCACCTTGTTGGA
ATATGACTCTAGTTAAAGTGGGGGAGGGACTCTTTTGAATGAACGCCTATCCGTCCCTCACTCATCACGTGCTGACCATGAGGTCACCACGTTCAACGGA
GAGATCGATCACATCGACTTGGTGAAGAAGAGGGAAGTTACAGCGAGGATACACTTGTAAACCAGGACACTGATTAAATCAGTATCACGCCTAGTGATTC
AGACGACACACTCGTTGAGACAGCGACTGATCTTGGCGCAGTGCACTCCAAGGGCTATCCAACTTAAGACATCGAGTCAGCAATCAATTCATACTGGCTT
GCGAAACAGTTGTCTATTTCTTACAAGACTATATCGCAGAGGCGGTGGATCGACAAAAGCGAAACGCTGACATAAATGGAAGGGCAATTGTTCTTTTATT
TGATAAAGGTGACTTAGTCCTACTATCTACGGTAAACCTACCTTGACACATAGTTACTAACGTGTAGTATTCCAGTTATTAGGTCCATTTCGTGTGCTGC
GCCGCCTAGGCGACGTACATACTATTGAGCTGCCACGTAAGATGTGCACGCATTCTACATTCTACTTCGGTCGCCTTAAGCCGTACTATTAGCACGGGGC
TTCTTCCGGTAAAGGAAGCCCTTGCGCTCAAGCATCTCCAACATATACTTGTGCTCGCGGTGCTGACTCTTAGCCTGCCTTTAAAGCTCGGATATCCCCT
TGAGAACCCGAGATATATCCTTACTCTTCCCCCAGCTCGTCGCGAAGAGAACGCTTTGCCCGTTCATTCTCAAGAGGGGCAAAGTCAAACGCTGAACTTT
CCTTCTCTCGATCTGATCTCAGACGGTTTACAATGCCTACAAAACTCCAGACGCCTGCCCCTCTCGTTTTCGAGGTCCTCGCGCAAGTCACACGTTAGGA
AATCAAGCTGTGACTGAAAGCATCAGGCTGGATTTTTAAATCCGTCGGAGGATGTATTTCCTCCTCTGCCTCATCCATCAGTTGATGCGCGCTTTGGCCA
ACTCTTCCTCGTGGAATGCCTGTTGAGCCACCGCGATGTAAAAGGAAGTCGGAAGAGTTACATCGTCCGGTGGCATGGCTATCCGCCTGGGCGGATAGTT
AAAACATTGCTCACAGCTGATGGTGGATGAGTTAGGTATTGTTGAGA