Description :
From Genome Similarity Track
Location :
Scaffold_652:3485- 5192
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_652-fgenesh-gene-0.2Cryptochrome

Sequence
1707 bases(100 bases per row)
CTGCTGAATGAACATCGACGGCGAGTGCACGGCGTTGTAATCCGAGAAGAAGCAGCTCGAGCTCACCCAGAGCCAGTTGCCGATGTTGAGCGGCCAGTCC
AGGTCGATGAGCTTCTCCTGGAAGAAGTACGCGCCGCGCAGCCACGATATGTACAGATCCCCGCGTGTGAGGAAGCACGCGACCGCGTGCCTCGCGACGT
GGTGCGCCCAACCCTCCTGCTCGATCTGGCGCATCACCGCGTCGATCCACGGGTACCCGGTGCGGCCGGTCATCCAGCTCTGCAGCTGCTCCATCGCGGC
TTTCGTGTCTTCGCTCCATACCGAGTCTGGTGGCGGCACCTGCTGCAGCTTCCAGTTGATCTTCTTGCACAGCGGGTTAAACTCCTGGGTGTCGAAGTTC
GTCACGCCCACGCAGTAGCAGTAGAAGAACTCGCGCCACATCAGCTGCCCGTCGAGCGTCACTGGTGCGGGACCTTTCAAACCGGGAAACTTGAGCTGAA
TAAACATGATGCGGTAGAAAAACTCACGCAGACTCACACATCCAAACGCAACGTAGGCGCTCAACGCTGTCGTGGACGGCTTCTCGAGACACACGGGTGA
CGTCTTTGGTTTCTGGAACAGCCCCACGCGCTCCTCGTTTGCGCAGAACTCGTCCAGCGTCTTGAGTCCGACCGTCTCGCCACCGTACATAAACGGGTGG
ACCTCCGGTGCGCTGTGGCCGAATGCCTCGAGACTCGGGATCACAAACGGTTCGTCCCTCGGCCCCGCGATCACCGCGCCGCTGAATGACAGATACGTGC
GGCAGTAGGTGTCCAACATCACGTACAGCTGGTCCTTCGAGAGCGTCCACCCAGGTACGAACCCCGGGCTCGAAGTTGGCAGACTAGGCTGCGGGAGCTC
TTCGACGATCTTGAGGAACTGCGCAAAGTCCGTCAGCGGCTCGCCTCCGTTCATTTTGATGACAGCACGGGGGTCAAACAGCGTCTGGCCGTGGAAAGTC
GCCACGTTCACACTGAAGTGGTGCGCGATCGCGCGCACGTCGTTATCCTGCTTGATGCCAAACGGCATGACAAACTCCTCGAAGAACAGGTCCGTGACGC
CCCACGCCGGGAAGATTACCTTGAACACCTCGGACGCCTCGCCGCGGAGTACCGCGAGCCCCGAGTGGCGCGCTTCCAGGCTCTGCGACAGGTCGAGCAC
GCACTCGAGCAGGAACTGGAACCGCACGGCGCCGCAGCGCTTCTTCACCGGCCGGTGGATGATGTAGATTGGGATGATCTCGGCGATGCCCAGGTCGCTT
ATCGCGCCTTGCAGTGCCGAGTTGTCGTGCAGTCGCAGGTCCCGCCGGAACCACACGAGCGCCCGTCGACGAGGTAGCGGAGATGCCTGCTCTACCGGTG
ACTCTTGTATCAGCTGGGGCTCGATCGCCTGCTTGAACGGTGACTCGGGCTCGAAGGCACTGACGTCGACAATGTCATCGCCTTCGTCATCGCCGTGCAC
ACCTGTGATCTTGTCTGCATTGTCGTCGTCGAACGGCAGCGCCGTGTACATGTTCTCAAAGTGGTGCTGGCGGTGGTCGTCGTCATCATCATTGACGTCC
ATGCAGCTCTCGAGTGTATCAGTCGCAGCGACGCCTTGGTCGTCTTCGTTGTCGTCCAGGTACGCGAGCGCACTGGGGCTCCACATTGCGTCGTCTGCCA
TGCTGCC