Description :
From Genome Similarity Track
Location :
Scaffold_56:34842- 36015
Sequence
1173 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGTCAGCGCGTGCAACGTGAGTTGCAGGCGTAGTGGAGCTTTCCATGGGC
ACCTCTGTATCCATGGGAAGGTTCTCAGCTCCGCGTTCGTGCGATGACGTACGAACTCAGATAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTG
TAGTGGGCCTACTTTGGCTCACTACTTTAGCTTACACGTGTGCGCGTGTATGTGAGGAAGCGTAGCTTAGTTTAAATTAGAGTTAATTATACTCGGGCCT
CCGAGTATAGATTAATCTAAATAAACGATCCAAATAATGCTTTTGGGTTAAAATGAGAACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCTAAATGTA
ATATTCTAAACTAGGAATCTGCCAACGGCTGGTTGGCAGAATTCCAATGCTATGCATGTCACTCATTGGCTAAAAGATGCTGCATTCAGCCAATAGGAAT
CCTAAGTCTCTATGGACCACCCGTCGTGGTGGTCGTAAATGTATGTAGCCATTGGTGTACCTTACACCAAGGT