Description :
From Genome Similarity Track
Location :
Scaffold_18:348363- 350727
Transcript NameFunction/comments
g6392.t1XP_002902924.1 propionyl coenzyme A carboxylase (Pi-PCC1) [Phytophthora infestans T30-4

Sequence
2364 bases(100 bases per row)
TCTGCACGTCTGCTGGGTCGCGAGGTGCTGTCCGCGCGCAGCGGCGCTTCGCTGCGGCGCCTGCAGCAGGCCGCGGCCCCGCGGGAGAAGCTTTTCGACA
AGATCCTCGTGGCCAACCGTGGCGAGATCGCCGTGCGCGTCATGCGCACGTGCCAGAAGTTGGGCATCAAGACGGTGGCCGTGTACTCGGAGCCTGATGT
AGACTCGGTGGCCGTGCGCATGGCTGATGAGGCCGTGTGCGTGGGGCCCGCGGCCTCGGCCCAGAGCTACTTGAGCATCCCCAAGATCGTGGCGGCCGTC
CAGGCCACGGGCGCCCAGGCCGTGCACCCGGGCTACGGCTTCCTCTCGGAGAACAAGGACTTCTGCGAGGCGCTGGAAGCCATCGGCGTGGCTTTCATCG
GGCCTGGACACGCAGCCATCCAGGCCATGGGAGACAAGATCGAGTCCAAGCAGCTGGCCATGGACGCAGGCGTCAACACGATCCCGGGCTTCCTGGGCGA
GATCGACACGCCTGAGGAGGCGGTAAAAGTGGCCCAGGAGATTGGATATCCCGTCATGATCAAGGCCAGCGCTGGCGGAGGCGGCAAGGGCATGCGCGTG
GCTTACAACGACGACGAGGTGCGCATGGGCTACCGCCTATCCAAGGAAGAAGCAGCCAGCAGCTTCGGAGACGACCGCATGTTCCTCGAGAAGTTCATTG
AAGACCCGCGGCATATCGAGATCCAGCTCATTGCCGACTCGTTCGGTAATGTGGTCCCGCTGCCCGAGAGAGAGTGCTCGATCCAACGGCGCAACCAGAA
GGTGATCGAGGAGGCGCCCAGTGTGCTACTCGACCCGGAGACGAGAAGGGCCATGGGCAAGCAGGCGGCCATGCTGGCCAACAAGGTGGGCTATGTGAGC
GCCGGTACGGTCGAGTTCTTGTGTGATAAGCACAAGAACTTCTACTTCTTGGAGATGAACACGCGTCTGCAGGTGGAACACCCCGTCACAGAACTTATTT
CTCACGTGGACCTAGTGGAGCAGATGATCCGTGTCGCTGCAGGTCACGAGCTGCCCAAGGAGTTGGTGGATGGACCTGTAAAGATCCACGGCTGGGCGAT
GGAGAGTCGCGTGTATGCCGAGGATCCACTGCGTGGTTTCCTGCCGTCTATCGGCCGGCTGCTTCAATATGACGAGCCCGTGCACCTCCCGGGTGTGCGC
GTGGACTCAGGTGTGAACGAAGGCAGCGATATCTCCATGTTCTACGACCCGATGATCTCAAAGCTCATTACGTACGGCAAGGACCGTTCGGAGTGTTTGG
AGCGCATGAAGATTGCGCTGGACAACTACGTTATTCGCGGCCCTGGCAACAACGTTGCGTTCCTGCAGGATGTCTACCGTCACCCTCGCTTCGTGAGCGG
TAAGATTACCACCAAGTTCATCGAAGAGGAGTACCCGGACGGCTTTGAAGGTGTGAAGCTGACAGCACCTGAGATTGAGGACCTACGGGTGGTTGGCGCC
ATCATGCACCTAAAGAAGGCTATTGCCAGCAGCCAAATCTCGGGCCGAATTCAGTCAACACCAACGGAAGGTTTTCCCTCCTTCGACTCGCTCAACAATG
ACGATTTGGAGTTTGTTTCTCATCAAGAGGGAGTTGTCCCGCGCCTGCGTGCTTTCACCCCTGGTCTATCATCGGCGGAGTTGATCGCGATTGCGGAGCG
AAACGACCTCAAGAGTCTCGGTGCTCAGCTGTCGGTTAGCATCGATGGACCATTTGGAGAAGCGAAGCCTGTCGTTGTTGTCGAAGTGGAGCTTGAAAAC
GCGCGGCACCGCATGGAAACGGCGACGCTCGCTTTTGTCGACAACAAGTGGCACGTTGTGGGCGATGTGGATTGGTCGCTGAACAGTCCGCTCTTCAAGG
CGTCATACGCAAAGCAGAACGGACCCAAAACTGCGCTGGCGTCGCAAATGCTGCAGACGCTGCCCGAGGGATTCCGTCTCCAATTTCACGGAGCAGTCCA
TGATGTCGTCGTACGCAACGAATTGGAGGCTGCGTACGGCATCCACATGAAGCCGAAACCCGAGGTCGACACGTCCAACTTGCTGCTATGCCCGATGCCC
GGCATGCTCATCTCAGTGGCTGTCGAGGTCGGCCAGCACGTGGAGCTTGGGCAGGAGCTAGCCGTCGTGGAGGCTATGAAGATGCAGAACGTGCTGCGCT
CTGAGAAGAGGGGCGTCATCAAAAGCATTGCGCATGCTGCTGGTGATTCACTCAAGGTTGACGAGATCATCCTCGAATACGAATAAGCGCTCTATGCTGC
GCTACAACTGGAAGGTCAACCTAGGCTAAGACGTAGCGGTGCACATGGAGATATGGAAAACAAA