Description :
From Genome Similarity Track
Location :
Scaffold_47:3483- 4965
Transcript NameFunction/comments
Phypl_g1738hypothetical protein

Sequence
1482 bases(100 bases per row)
CTTTGCTTGAGACTCGTGTCGACTCAACACACCGCGTAGTTGCTGAAATATAGCGTCGTAAACATGGGTTCCGGTGTGGGGCGACCATTGCACCTTGACT
GTCATTTTCAGGTGTAGTACCACGGTTACGTGGGCCACTTAGAAACGCGTTTCGTCTAGCATAAGCAACGCAGCATATTGTCACGAGCCGTCCTGATTGG
GGGACGGACAAGCGTCGTATCGAGGGAGCGAGTACTAGGGCGACAACCGAGCAAGCCAAGCGTAGCCTAATACACCAAATGCATTGACTTGTTGACTTGA
GTATAACCAGGCAAATTCACGACTGACCTTAACCTTGGCTGCGAACTCGactccgccagcgcgcacGCACTCTTCCTTCTCCCGGCTGGACCTCCGCCTG
ACATCCCTCCTGGCCGCCGGTCCCCCGTACCTTGGCCTCGATAGTCCCGCCGTGCACGACTTCCGTCCTCCCCAtcctgctcctcgctgtGCCGCCAGAT
CCGAGAGTGGCAAtggcagctcagcgagcctGAGAAACCAGCTCGGTCGCGCAGAGACACTCCAAATCTGCCCGTTTACCAACCACTTGCGACCGGGCGC
CGAGTCCATCATCATACAGTTGCGCCTCCATAAGCTCCTCGCCCGTTGGACTTGCGCAGGAACGGTTGAGACCATCCTCGACACGGTGCCCTCCATTCTC
ACTCGTGACAATATTGTTGTGCAGGACATTGAGGGCGGCTCCGTCAAGGTGACTGCCGGGGCCGTCGAGGAGAAACAGGGGAAAGAGGTGCAGCAGACTG
CAGGTTACCTTGGTGGGCGAGAGGGCGGCAAATAACGGTGGCTTAGGCTTGTCTCCACGGAGGTACCAGTAAGGGTTAGGTTAATAATGGCATTTGGCGA
ACAATGACCTCTGCTGATAAGTCAACCGCATTTGGTCGGATATAATTTTTTCAAGACTGCTTCGTCAACTTACTGGGGGCGACACCTTCTGCAGGCTACA
CATGGTCTTAAGAACATCACAGAGTGTTTAAATCGATCAATGGTATAGCTATGAATATCGCTGCGGCGTTCGTTATTTCAAAATCTCCCCCCCACTTTCA
GCTCCGGTTAAGTCTGGTATACCCTGTTAAATTACAACGCTTCTCGCCATTcgcggtggagatgctctcaATACACCTAAATTCTTCATCAAGTAGATGC
AAACCTCTGAGAGCGTTTAGTATCACATTGACACCTGGTTGATAAACACAGCTTTTTGCCGCAAGGCACTTGGTGCATTCTTGCCAACAGGTCGATTCAT
GTGCTGTACAGTGATAattgcccccccccctccccaaCTCGCTGGTGCCCGGAATGAGGTCAATGGCGCTCACCCGGCACAGACGCGGATACTATCCGGC
AAATAAACCGCCCAAGCCCACAGCGTGGCGGATTCCTCGATTCACATGAGCTTACGTGATCAGCCATTTGCGTCGTAATCGT