Description :
From Genome Similarity Track
Location :
scaffold_7:348189- 351277
Transcript NameFunction/comments
Plaha_PHALS_03520hypothetical protein

Sequence
3088 bases(100 bases per row)
CCTTACAGCAATATTTGTGGCAGCTTTAATACGCCCGTACCATTTCACATTCTTCTGAGTATAACcaaccactcccagagcatactcTGGAGGTATTATC
CCCCGACGCTGCCTCCCAAGAAAGGATTTCCTAGTCCACCCTATTCACAAGTGAACTGaatcttttgcaataaaatcGTCGAATCAAACTGCTCCGCACG
GGGTGGTCACAGTACTGCTGATTCACAAGGATGGCCTATTTCTCGTAACTATAACGCCTGACCTATTTTCTGTCATTCCCAGTCACCAATTTTCGAAAAC
TCTTGCTTAGGAGGATGCAACAATAAACCACTCGTTACATTCCACCAGAGCTCTTCCGATATTCCCAGCTTACAGGTGTTATCAAAATTCCAACAAGAGA
TACGCCTAGAAAACAGCAGCCTCTGTCTCAGCAGATATAACTTTTAAGACCGTGCTTTACAATCGCTTATTCGCGTCTCATCACATACGTTCATATTAAT
TCGGACAACCCAATGTTCGGCACCAGACTTACTTCACCAGAGCCCCAATCACAAATAGAGTAATGCATGGGACCTAGCATATTCAGCTTTTAgccgatcc
atggctcgtggcgTTCCCGCTACGCCATATCTTGAAAGAGATGGTATTCCAAATtctccacgctgtcaaagccCACAAAAAAGCTAAAAGAACGTTCGAA
ATGTCTCCATTAAAAACAAGAATGGATATGGTATTCGTGTTCGGCATTATCGATACCTCCGCGTGCTGTCTTCGTTCATTTAGTCATGCGCCATACATAT
ATATACGACAACCCTAACTCTGACATGGTTTCTCCCCCGCGTCCCATCTATCGGTGCTATGATGTTGATAGTATACAAGactggtgtaacggggttacat
gtgcTCTAGCAAGAAAGGgccggtcgcacaagattgtgcgaccgtacatagctgtgttattacacaattagtgtaataacacagtggcgtgactacaccg
taacaagtgGCAGGATTGTCAGTACTATgacatattactatattaattaggtttgctACTTTAAAAtagatattactatatcaattagggAAACCTAGGa
tcttagatattggcggctctgccgcaactaaaacaatttaatacagtatcaatttttgaacagaggtattcgtttgccttggttaaggctttagtactta
gaagtagcggattgcgatccgctacacttgtactagtACTTGTACACAACGTAAGGTccgtgaccttagcttagcttcctctaagcaaagtgcTACGGCA
GACTCGCTGCACTCGGatgcactcgtagtcaatctacgtctgagtcgttacgactgatcctctgtgtggatggaggaatactcctatttgccccagggta
tGACGAACGGGTTTAAGAAGCTGATCTCCATGCTGGGCTATGAGGacgtggagcaccttgttgTAGGCtataaaatgctctgtttgaGCACCTAAGccaa
agctgtcagcgtcgactgcatatatgatgccaccgtcgacgacggataattccttccgacccaggccgctcatggtgaacgTTAAGACCTACGAGGGTAA
GAATGTGGACAATCTCCTTCTCTCGTTGAGAAAGACCGAAATAGCCACGTTCCAAAAAGAGGAGCAGCTCGTGGCACTAGCTAActtcaagctcgggggc
tGAGCGCCAGagtgggcactaacgtgcggtgctttgattgaagctgcgttctcCTCCTAGAAGGGACTGAAGCGTTagattttgcgagtgttctcgccgc
ctaatcaggcatattgcgTGAGAGTTTTCTAactgcccgacagggtaaGATGGAGTTGGTGGATTTTGTCCAAAAGTTGACATTTTTTAGTGCCGGAATG
ATAGCAGATCCTcctcccgaggcggtcgcagtgaccgtctgtatggagggcctccacaCTGGTGTGTCCAGAATGaaaatcttccgtgtgcattcgcctt
cttttgatgaagcagcaaacgtggcattgaatgccgaattcaacttcggGTCGGCAcggcttggttggaatgcacaccctcagagcccgtcgagcgggcc
tgagccgatggatttcAGCTAGGCTGAGAAGTAGGAGGGGGagttccgagctgctgagcagcgtgtagaCATCCGACGTTGTTTTATTGGTGGAGAcccc
cgtcaccttcggacgacTtatcccttgcgcaaggcgcgtaaaggttcgtcgaaccgacgtcctgcATCTAACCAGCCTGTTTTGTCGCGGGGGAAACaag
aacacccagtaggcgcgggtgccctactgggggagaactCAGTTCTGCTGAGCCTTAAAGAGGTAGAAGCCAGCTCCGAAGAGCTGTGTGTTCTTTTACA
CGGAGCGTGTGCGCTAGctgagcttgctggtcgtcaAAGAATCCTTGAAAGGCTTTGTTAAGCCATGATAGTTCCCTAccgattctggtgcgtcgggcaa
gtatgctcgacgctccacaatcggaggaagtcagctgtatgctgaggcgctatatacgcggttgagtgacaccactGTTctcttagcgacggggacttgc
gtCACTAAGCTGAGGGTCCCTgtagacctcggtgtcaagcttcttgacttcgatagcgtggaacgctgcctagtcttagacttggatgcaaggtatgacc
ttattcttggtatgacatggttggagcaCAATGATCCATGAGAAGATTGGGGGTTGAAGACCTTGGCGCTTCGCTCTCGTCTCGTGGTCGAGCTGTGGTG
AGTCAGTAacctacctctgctagaaagtagaagcgctattagcgcgggcactggaccgagacagcCACAGTGCTAgacatcggagtatccgagttattGA
ACACCAAACgtgttttggacaagagtccccgagcgtggctcacgggctgaacgtggagtggcatgtaacccactcagcgctgctcaagtattggagcagt
cgctgcataccaagagtggcatggtcggccaaggtcCGATGCATGAAGGGAGAGaccacgtggagtggcacgtaacccactgagcact