Description :
From Genome Similarity Track
Location :
Scaffold_32:34804- 37060
Sequence
2256 bases(100 bases per row)
ATGTGGCCGATGTGCGTCTCGAACGCAAGATTCGGTATGATTATGCCAGGATTAAGGCCAGAGGCCAATTCTGCAATCGCACGCGCTATGATTCGGATAC
TACGGTTGCTGCGAGTGCTGGTCAGACTGTGACCACCAACCCGCCAAACCACACCACTAGTGGTGGGAACGGCCTCGGTCACGAGATGATCCTGGCCACG
ATGTTCAAAAACAGCCAAGACGTATGGGCAATCTTGCCGAAGGGGTATCTCGTACTCCCATGAGTTTTCCGACTCAGGGTACCCTCACCACTTTACCAGA
TACTGGTATTGGCCATGACGACGGCGTCGTTTCAGTAGTCTCTCGACATGAAACTGACGATTCCCGTGCTCATCGAGCAGCGTCGGGGATGGCCGGTATA
CCGGTGGCGGACCACGAGAAAATGGTTCTCGAAGTGAAGGGTCGCCAAGAGACCTTGGGTAAGACCCAGTGCATGCTGGATACGATGAAAAGCCACCTTC
AGGCGATGGAGCGTGCTCAAACTCGGAGCGAGACTCAGTTGGACTTGCTGATTCGCTTACAGCAATCCGGGGCACATCCCTCGTCGTCGGCGCAAGCGCC
TCCAAGTTCACATGGGAAGGATCCAGGTATGGCTTAAGTAAGCCTACGTAGATCACTGGGAGTGTGCGCAATTTGCGCGGAAGGTTTAGCGTATACGCAA
GTCCCTTCTTGGCAGTGGCCGTAAATGGTCCAATGAAGCGTGGACGCAGCTTTGTCCTGAAGACAGCGGATACTACATTTGTAGGTAGGTTTTTAGCATT
GATTAATACTTGGTCCCCGACCTTATTACGTTCAATTACAACCTCTGTTTTTAGCATATGCTTGTTGTTTTTGTCGGTCTTGGCTTTCAGCCTTTGCGTC
ACGCACATGGCTTAAGACATTTAATCGCATTGGGAGAAACTCGCCTACCTGTTTTTGAACAGTAGCAGGGCTGATATCAGCAAGCCGATCGGCAACCTCT
CCCCCACCAATCCCTGAACCACATAGTAGTAGCGATAACGGAACTCGAGGGTGGGTGAGGCCGTCTACGTAGAACTTAGTATAGCCTGTAGAGGCACAAA
CAGCGTTTCTCAACGCAAAATCAACAACAGGGAGCATGGAGCTCCAACGCTTAGGCGTATCAACGAAAAGACTGCGCAAAGTGTCACCAATGACGCGATT
AGCACGCTCAGTTTGATCATCGGTCTGCGGATGATCCGCTGTGAACATGTCCAAACGGGTGCCGAGCACCTTGAAGATGGACTTCCAAAACTTCCCAGTG
AAGCGGGGATCTCTGTCAGAGACAAATGCCACTGGCAAACCATGTTGTCGATAAACAGCTTCGCTGTACCTTCGGCATCAATAGAGTCCAGCACTGCCGC
TAGATGATCCATCTTGCTCAATCGGTTAACAAATACCGCAATGCCAGTGTTGCCTTCCAAATCTTTCGGTAGGCCAAACACAAAGTCCATACTCATGGAC
TCTCAACACCCAGTGGGTACAGGCAGACTAGCCAGCGGCGCCGCCGCACGTGCTGAGGGTTTAATCCGTTGACACGTTTCACACGTACTCACGTAATTGC
TCGCCCACTTGTATAGTTTGGGCCACCAATAAGCCTGGATCACTGAGCTATAGGTCTTCTCACAACCGAGATGACCACCTAAACCGGTATCATGTGCCTC
ATAGAGGATTCGATACTTCAACTCCCCATTATGAGGGACAGCGATACGAGGGTTATCCTCAATATCTGTGCGATAGCACAAAGGACCATTATCGATAGAA
TATCGATGTATCCTCGCACGTAAACTTGCCGACAATTCTATGTCTGAGTCTTTAACTCCTCGCTCCCAAGAGCACGTAGAAAAGCTACACATTGTTCATC
TTTGGCATAAGCCGCACGGATTAAGTCAGTGACTGACGATGACAGCGTAGTGACGTGAGCAAGCTCATAGTCAGGTCGGCGCGATAGCGCATCAGCCAAA
GCATTTTGCTTTCCTGGATTATACTTCACTTCGAAGTTATATTCTGCAAAGAATGAAAGCCAACGAGCCATTCTCTGAGAGAGATGCGGCGACTGTGTCG
CAGTGCGCAATGATCCATGATCTGTATAGATCACAAATGGCTTTGAGCCAAGCAGATGTACTCTGAATTTGACTAGAGCGTACTTTATAGCAAGTAGCTC
TTTGTCATGAACTGGATAGTTCTTTTCAGCAGCTTTGAGCTGTCAAGATTCGAATG