Description :
From Genome Similarity Track
Location :
Scaffold_13:348021- 350335
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_04417Hypothetical protein
Sappa_CBS223.65SPRG_04418transketolase

Sequence
2314 bases(100 bases per row)
GCGCTGGCCAGCGACTGACCACCGCCTTCCTGGGCGGCTGAGGTACCTGTGAGGTAAGTGGCGGGTTCACCAAGATGCGAAGGCTCTGCTTGTTCCCAAC
GCCGCGAGTCGCAACTCTAGCACTCGGACGGCTCAGACTGTGTTTGTTCCGCGTGGATGGTCATCGACTGGTATTAGCGGACCAGTACCAAGGGTCAATA
GAATATCTTTGTATTGACCGTGCACAAGTCGATATCCGGACGCATTGCAATATTTGGTGAAAAGATACTCTCGTCCTTGAGTGGCGTACCCTCCCGTATG
CTACACAACGAGTCATTTTCGCATTGCCATGGTCGTGTACTACACGCGCAAGTACTCGAGCGTCCTCGACAAGGTCGGATGGCGCCGGTCTTTTATCGCT
CTCGAGGTTCACCCCGACGTCGGCGTCCTTGTCGTCCTCAACACTAATGCCCACTACCCACTCGACACGATTGTTCGTGTTCAATGGCACACCAATCTGA
AGGCACTGATCGAGCTTCCGGAAGACGACAGGCTCTGCGTCAAGTTTGAGACGCCGGACGCGCTCAAAGCCTTTCTCTTTCACCTGAGCGTGTGCCCAGA
GACCGACTCGCGGGGCAACATCGCGCCAGGCATCTACGTCAACCCGGCCTTGGGCCACAGCAAGCACGAAGCCGCCCTCGCTACCCTCGTTCTCGGCTCG
ATGCGGTCCTGGAAAGCCCACCGGCTTGGTCGAAAAGACCGCAGCGGAAGCCACACGTCGGCCTCGAGTCGCACGAGCAACCCGGGCTGGGTGGTGGCGT
GATGACCGTCCATTTTCTTCCGCCGTCGGCGCCACATCGATCGAAGATTTGGCGCAAAGTAATGTACTTCAGTATTTATTGTTTTATTGAAAGGTGCCTG
ACGCTCGAGTTTGCACTTTCTCGCTATGCACCAATATCATCGCTTTTGGCAAGAAAGTGGTCGACTATCGGCCAACAGGAGACCGTTGTGACCTGTCAGC
GCGGCTGCTCCCCTGTCGATCCGAATCGCTTCTTGGACGGAGCAAATAGATTGTGATTCAAACCCTATATTGTGCGTGGAAATACTAGTGATGCCTTAAG
TTAACGAGAGCGCACGCCGTCCGAGCTTGATGTCAGTGGTATTCGCTATTGCGTGCATCTCCGCGGACGTCGTCTGGGTCGGTTCCTCGGGCTTCATCCC
TGCAGCGACGTGCGTCGAGTAGTACACCAGCACGACGCAAAGTGTCACAAACGCCAGCGCCTTCAAAATCAAGTTGCAGTTGCCACTGACGAGTGCGACA
AGGCTGGGCGGCTTGTTGGCCGGTGCGACCGCCGGTGCTGCCTCGGTGCTCTCGTCGTCGTCGTTGTCCGAGTCGCGTCGTCGGCGTCGGTGCTTGTTGC
GCTTTTTTGACTTGGATGCAACGAGCCGCACAAACGATGGCTGCGATGGTGAACCCATGCGCAGGTAGATGGACCGCGACGACATGAGCTCGTCCATGTT
GATCGAGAGGTGGTGAGGCGATGAGGACGACGCCGATGTAGACCGCCGACGGCTCGTCGTGGGCGCCGCGACCGGCGACATCGTGTGGTTGTCATTGCTG
CTGTGGCCTCTGCCAAGATGCACGCGAGCGGTACGGCCACGGGGAGTGACGACGATTTCGGTCGGGATAACTGTGTCTCGAGAGCGGTGATCTGTCGCCC
GGCGCTCGATCGGTGCCGGTGCAGACGATGGCTTCAAGTCGAGGGGCAGGCACGGTGTGACGGTGGCAACACCCGCAGCCACCGTGTCCTGGCGCTGGTA
ATACGCTTGCGTGACGTCGCGCGACGGGTACGGTACAGCCATTTGCACCGAGTCGTCTTCGAGAAGGAGCTCCTCCAAGATCGTCATGGACGGCGCCGAA
GGGTCGGGCGTTGGGAAGGCGAACGACGGGTTTGGCGGAGTTGTATACACTGGAGACGGCGTCCCGCTGCTTGTCGTGTAAGGCTGTGGGCTTTGGTACG
GCGATGCGCTCGACGACGGCGTTGACATTGGCGTCGAGTTCATGCGTGTGAACGCCGGCGACTGGAACCCGTACCCCATCGGCTCGTACATCTGTGGGTA
CCCCATCGTCGACGGGTGAGGCATTGTCATCATGCCAGGGTGGCTAAACCCGCCAGGATACGCCTGCGGGTACATGAAGCTGTGTTGTTGCTGCTGCTGG
AACATGAGCTGCTGCGCGGGGTTGGCGAAAAACGGGCCCGCGTAGCTGTTGGCGTGTAGTGCACTCTGGCTTCGGTGCCGCAACGGCGAAGACACTGGGC
GGTGCAGCTGGTGG