Description :
From Genome Similarity Track
Location :
Scaffold_1187:348- 7131
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1187-fgenesh-gene-0.0ATP-dependent chaperone ClpB
Pytiw_DAOMBR242034maker-piw_contig_1187-fgenesh-gene-0.1Gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_1187-fgenesh-gene-0.2Glycosyltransferase

Sequence
6783 bases(100 bases per row)
GCGATTGCGGCTCCAGCAAGAGAGCAAGCCCGAGCCGATCGACAAGCTGGACCGCGAGATTATCCTGCGCCGCATCGAGATCGAGGCGCTGCGCAAGGAG
ACAGACGCGGCATCTAAGAAGCGCATGGCGCAGCTCGAGCGCGAGGTTGAGAAAGCGTCCAAGGAGCTGCGCGTGCTCCTGGACGAATGGAACGCCGAAA
AGGAGAAGCTCGAGGCCATGCAGGAGGCCAAGCGCCGGCTCGAAGAGGCACGACGCGAGCTCGTCGCGGCGCAGAACAACGGCAACTATGGCCGTGCGGG
CGAGCTCCTGCACGCGATCATCCCCAAGCTCGAGCTACAAGTCGCTGAGGAAGAAGAGAAAGAGGTCAGTGGCGATGGTGAGCACGACCCCAAGCTCAAG
TCCAGTCTCGGCGACGCTGTCACGGCCGACCACGTGGCCGAGGTCGTCGCGCAGGCCACGGGCATCCCTGCGTCGACTCTCATGTCGGGCGAGAAGCAAC
GGCTGCTGCACATGGAGGAGCACCTGAACAAGCGCGTGATCGGCCAGCAGGACGCCGTGCAGGCGGTCAGCAATTGCGTGCGGCTCGCTCGCGCAGGGCT
TCACGCGCACAACCGTCCATTGGGCGTGTTCATGTTCCTCGGCCCCACTGGTGTGGGCAAGACGGAGCTGACCAAGTCGCTGTCCGAGTTCCTCTTCCAG
AGTCCGCAGGCGCTCACGCGCATGGACATGTCCGAGTACATGGAAAAGTTCAGCGTGAGTCGCCTCGTTGGCGCGCCGCCGGGTTACGTGGGCTACGAAG
AAGGCGGGACGCTCACCGAGGCTGTGCGGCGCCGACCGTACCAGGTGGTGCTCTTCGATGAGTTTGAGAAGGCGCACCGCGACGTATCCAACATCCTGCT
GCAGGTGCTGGACGAAGGCCGGCTGACAGACTCGCAGGGCCGCCTCGTGGACTTCCGCAACACGGTCGTGATACTCACGAGCAACCTGGGCTCCGAGATC
CTAGCCAGCCTCCCTGAGGGCGTGCCCAGCTCGGCGGCCGAGGCGGACGTGCTGCGCGTCGTGCGCGGCCACTACGCGCCCGAGTTCCTCAACCGCATCG
ACGAGCTCGTGCTCTTCAACCGACTGGACCGCGACGCGACGCGCTCGATCGTGGACCTGCAGTTGCACCAGGTGGACCAGATGCTCGAGGAGAAGGAGAT
TCAGGTCAAGATCGACGCGGACGCCAAGGATTGGCTCGCAGCCACGGGTTACAGTCCGCTCTACGGCGCCCGCCCGCTCAAGCGCCTGATCCAGCACGAG
CTGCTCAACCCCATGGCGATCAAGCTGTTGGACGGATCGATCGGTCCAGGCCACAACATCCGCGTCAAGATGAACCCGCGCTATGACGAGGAGCTGCTGC
GGGACCCGCGACGAGCCAAGCCTCTCATTGTCGAGTGAGTTAGTTAGTAGACGTGATGCATCGATTACATGGTGACATTTGCATGGAAAGTTGAATTCTA
TTGGATAGCATGACAATCACTCAATGGCTCAGATTTGAAAAAATCATGACACGCATGGGAATAAATCGGAACCCCCACTCGCAGTCTTTTTCGCTCTCTC
GATTCACGAGTGACGAGCTACGCGTTGATGTTGATGCAGTCGGGCCAGGTCATACCGACGACGGAGCCCTTACCCTCGCCCGAGAAGCACTGGTTGACAT
TCTGGGTCGGCACGTCCTCAATGCGCAAGTAGGAGGCGCCGAAGAACCGGTCAAAGTCGCCCGAGATGGAGAAGGGCGAGATGTAGATGGCCACGCTGGT
CGGTGTCACGAGCTTGACTCCCGAGCCGTCGGGTCCGCAGTGCGTCCAGGGCATGCCTCTCGTGCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNGTCCTTCCAGTTGTACGAGTTGATGAAGTCGCCCACGATGATGTCCCATGCGTTGCTAACGCCGTTGGACACGGACTCGGCGCCGAAGTG
ACCGTCCTCGTATAAGTCAAAGCCCGTCGGCCTGAACGGGTCGGTCGAGAACTTGACCTTGCACAGGAACGGCTCGGCGTCCATGTTGCGGAACTGGTCG
AAGACGGACTGGCCCGTGAGGAACCAGTCGGTCACGCCCACGGTCTCCTGCTTGGAGTCGAAGCACCGCGTGCCGTTCGGCCCGCCCACAATCGAGTCGA
CAGTGGTGGTGCCGTTGCAGTACAGGGCGTAGTCGAAGCTCTTGATCGCGTCTGTGGCGATGTTCTGGCCCAGGACGCCCGTTGTGGCGGTGAGCGCGAC
GGCGGTGAGAAGCTTCCAGGAGGACATCGTTGAGGTTCGCAGGTGGTGAGTGGTCGGCAGAGCGCGCGTTTGGGAATGAGAGCTCTCAGCTACAGGTCTC
GCTCGCCCTTGCGGCTCTCGTTGTTCCCTTGTTCATCGGCAACCGAACGATGGGACTTGCGCACATCTTTTCTCAGGCACGCGTGTCACGGCCGCCTGTC
ACATCCTCAAGGTACACTTCCAGGAGGCTTAACCTACCACGAAGTCTGTTCTGCCAGAGGACCGGACTTCCAGTGATTCGGGATCGCCTGATCAGAGCAG
GGCCACAGAGCTGAATTCATCGCGAATCATGGTCTCTTTGTCAAAAAGTGTTGTTTGTTCGTTTCTTTACACATACGCACAAAAATATAGAGAGAGCCTT
GTCTCCTGGTCTACGAGTGCTGGTCTACGCGTGCTGCTGCATGTTGTGCTGCAGCGGCGCGGGCGCGGCACCGGGGGACTCGAACATCTGATAGTTGCCG
CGGCCTTGTTGCGGCTGCTGCGGGCCGCCACCGGCGTTGGACTTGGCGCGCGCGCGACTGAGGTTGCGGTTGCGCGCGGTGCCCGGTGTGCGCAACGTGT
TGCGGCTGGCGGAGCGGTGACGCTGCGCCTTCTCGCGATCCACCTGGGCCTCGTGCTTGGTGCAGATCACGCCGTTCTTCTTCGTGCCGGCGCCCACGAG
CAGCCCCATGGCCACGGCGCAGAAGCCCGCCAGCGCGTACAGGTACAAGTATCGGTTCTTCGTCATCGAGTCCGACGTCTGCATGTACACGTATCCCAGC
GGCGCCACGAAGAAGAGCGCGAAGAGGAACGTTGTAGACACAGCGCGGCCGCGCGTGTTGAACATACCGATGCACGCCGTCCACAGCGCCGCCGTCGTGC
CCAGCCCCAGGAAGAAGTACATCAGCATGCAGATCATCGAGTAGTACAATCCGGCGTTGTCCAGGTTGTTGAGAAAGCCCGAGTTCTCGTTGAACCCCAG
TACGCCCGCGCAGAGCGCCACGGGGATAAGCGTACCGAAGAGGATCGACTTGTGGTCCAGTTTGTCAATGAAGAAGAACGAGAGCAGCGAGCCCGTGAGC
TGCAGCGCCACCGAGCTCACAAACATGCGCGGCTCGTCCTTCAAGATCGTCGACGACGTCACCTCGGCCACCACGAACGCGTTCAGCACGCACGTGGACA
GCGACGACACGAGCATGAGGAAAACACCGAGGAGGAACTTGAACGCGTTGCCGCCGCCCTGGTCGTCGCCCGTCTCCTCCTCGCGGATGCTCTTGAGCTC
GTCCGACACGTCGGGCTTGCGGCGCAAGATCACAAGGCATGCCTCGCACGCCTCCCAGCCCTTGCGCTCGAGGATCCAGTACGGGCTCTCGGGGAAGATG
TTGACGGCCGGCGTGATGATTGCAATGATCACGGACGCGCCAAAGGCCTGCCACACCCACCCGAGCTCGTTCACAGTCGAGAAGTACCCGTTCATCATCG
TGCCCAGCACGAAACCCACACCCAATAGCAGCACTGACTTGCCGCGCATGTCCTTCGTCGAGATCTCAAAAATGTACACCGCCAGCGACGGCAGCAGAAT
GCCCACCGAGCAGCCGAGCAAACCGATACCCGGCAGCAGCATCGTCTTGCGTAGGTCGCCGTCGGCGCACACTGCGACCATACCCAGCGTGCTGAAGAGG
CCGCCCGTGACGATCGCCAGGCGGCGGCCGATGAAGTATGTCAGGAAGCCCGACATAATCGTACCCAAAACGCACGCACCATACATCAGGAACGTGATCT
TGCCGTCGCCGAGGTCGCCACTGAGGATGTTCTCGTAGGACGCCACGTAACTCGAGAAGCTCGCAGACTGCTCCAGCGTCGAGAGCAAACTGAATAGCCA
ACCGCAGCCGGCGCCGCCGAGAATGCCCATGAAAGTCGCCAGCGAGAACGCGTACTGCGATGACGCGGACATCACCTTAGAAAAACCCTCGTTGTACATC
ATACGCGTCTGGATCACGTTCAGGAACGGGATGCACGACATGATAAACAGTGGGATGATCATCGCCGTGCAGAACAGGAAGTCGAACAGGAACTGCAGCT
GCTGGAACACCACGATGCTCGCGATCGACGAATTCGGGAAGCTCCACATGCGCATCACTTCGTTGATACCGTAGAGCCCTGCCGCGTAGCCGAAGAAGAG
AGAGATCGAGTACTTGAAATCCTTGTCGAAGACGATCCACATGGCCAGGAAGTACGCCGTTACAACAGCCAGTACACACGTCAGGTAAATCCCCGCACGG
ATCAACGGACGAACGGATTTCATGCCGAGACCAATTCCGTGTACGAAGCCCAGCAGCACAACCGTCGCCAGCGCAGCACCAAACACAAAAGCGACGTATT
TCACGTCCGAGGTCTTCATCGTCGACACGTAGAACATCAAAATGAAGTGTCGACTCTCGCGAAGCAGCACCGTCACTCGGGAGATCATGTTGGAGCTGTG
GAGCTGCTTGAGATCTCCCTTCCACCACGTTACCCATCCGCCGGTGTTCACTGGGTCATCGTCCTTGTAGTCCTCGCCGACGAACATCCAGTTCGCCCAG
GCAGCAATGTCCACCTTCGTCTTCTCCCAATCCAAGCCGTCCGTGTTGAACATGAACGGCCCGACGATCCAAAGAATCGAAATGAACCAGATCGAGAACG
TCTGCACGCCGTATCCTTGAGCTGTCTTGCGGAACTCGAACGCAAACATATCGTCTCCGATAGGCGCATCTGTTTGCCCGATGAAGAAGTTGCCGAACAC
TAAGTAGACCATACAGAGGCCCACCAGCTCGAACGCTTTCCGATAATGGGAGCTTGCGTATGCTTTGTATAACAGCACCAGCGTCTCTCGCGTAATCTTG
AAACCACGACCTGTCGCTTGGTACTTGGCGCCACCGTGCAGGATGTTGTTGTCGAAGTAGTGCATCGTCGTACCCACTTGGAAGACGAAGAAGGCTGGTC
CAAGCGTGATGATCATCTCGATGAAGCGGTACATACCGCGGACCAATCCACCTTCACCGAAGTACACGCACATCAGCGGAAGCATGAGGAAGGTACCGGC
TTGGATGTAAAACTGGGTGTTCACCACCGCCTTCAAATCCGTGAGCACGCGCGCGTCGAATCCTCCAGCAACGTTGCCCTTGATGAGCGCAGTCGAGTTC
ATGCTAAAGATGATCTCCGACTGAACACCGGACAGCGCCATGTACACTTTGCAGTACATGTACACGAACGCAGTCACAATCGTCATCCACGTCGCGTAAT
AGAAGCCCGTGTGCGAGTAGAACATCGAGTTCAGACGGAAGAAGTCCAAGAACTGCCCCATGCGATGAGCTTCGCGTGCGAGCGAGGTTTCACCGGCACC
GTTTGCCAGCTTTGCTTCGAACATCGAAATCTGCGACAGAGCCACATCACGACCCTTGCCGCACTGCATGAACTCCACGTGCGTGACAACGCCTCCGCGA
AGAGTCGAGTTGAAACCAGCGAACACATCCTCCGACAAGTTGATACTCTTGCTTGCCTTGGACACACCACCGCGGGAAAGTGCGATAACCTTGTCGAAAA
TATCTGGGTGACCGTAGTGCATGCGCACGTAGAGAGGATCAGCGAGCACACGCTGCGACAGCGTCACGAACACCAGCTCTTGCCAGGACTTGAACTTCGA
CAAAGACGACGCGTTACCCGTGAAGATATGCTCACGCATGCCGATGATGGAGACGGGCTTCTTCGACGGATGCTGCTCGGCGGTCACAAGCAGCTGTGGC
ATCTTGAGACACTCCTCGAAGTAATGCTGCTGGTTCATATCGATGGTCTGCAAGAACTCGCCACGGGTAAATTGCAGCGCGTTGTTCTGGTTCTCCGGTT
TGCCTTCACCAATGATCGGATCACCAGGAAGCTCGTAGCGATACACCTCCGCGATTTCCTCGTTCTCGCTCTTGATTAGCACAGTGTCGTACCGCTTTCC
GCCATCTTGTTCAATCGTGTCCACGTACGCAACTCGAAGGTTCGGGTAGGTTTTGAGGAGGTAGTCGATGTCATCAGCCTGTGTCTTGCCTTCAGCTCGG
TGCTTACCGTACACTTGACACGCACAAATGTACGAGAACTTGAGGCGCACCATGTCTTCAAGCTGGGCTTGCTTCTGCTCGGC