Description :
From Genome Similarity Track
Location :
Scaffold_8:34799- 38134
Sequence
3335 bases(100 bases per row)
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG
ACTTCCATCGGTCAATCATTACTGGCCGTGCACGACGATAATGGCGTGGTATACATATTCTCGACCTTCGTGCGTCTCGATATCGGGGTTAGTGCTTCCG
ACTGGTAAGGTGGCTTCCAAGTTGATCTTGGGCCCCAACCTTGAATCAGGTAAAACGGTGTGTCTCCACAAATTCGATCATGAGAGGTGTTGATCGCATA
AGTCAACCGCTCTGCATATTCGTCCCATCCCTTTTGAATTTCATCGATGAAATACATCTCGATCGATCGAGTCAGTGTCTGTACCATGCGTTCGGCCGTA
CCATTCGCTTGCGGTCTATATGCCATGGTGGCCAGCATTTTGTCCCGCGATCCGATTGAACGCTAGAAAGAAATCGGATATAAATCCTGGCTCGCGATCA
TGAAGTATCGCCTCACTCGCACTGAATCGTATGAACACGCATTCTTCGTAATTTTCCGCGATCGTCTGTGCGGATCTGGACGAGCTTGCTTTCGCGATCA
CATAACCCGAAAATAAATCGACCCACAGTAACAGCTCGGTTTTTCTTTTAAAAGATCGTGACAACGAAGGGATGTGATCCATAGCTATAACCTGAAACGG
ATAAGTCGATTGCAAATTACCAGGTGATCCACTCCGATCACCTGGTCGTCCTTTTCCCGTTCCACAATCCACAATCCACATACTCTCCTACATACCGCTG
TACACTTCGATACAACCCACGTCAGTGAAAGTTTGCCCTGATCCGTTGATAAGCACGGTTGATTACTTGATGAACACCCTCCAAACTTGTGTGGTAGTGG
TGCAAGAAATCTGCTGCAACTGCTCTGGAACCACCAGACAAGCCAGTTCAGTAAACGTTCCTCCAATTCGGTGGCCGATCTTGGACAGAAAAATAGCAAA
CCATTTTGGTCTACTTCATAATCCTGTTCAATCCGGGCGTTAAACTTTGACTTCAGTCGCCGATAATTTACCCACATCTCCAACCAGATCTATCTTCGGA
CTGGATAGCCAATTTTCTTCGTCTTGTGCTTGCTTAATGCGATCGACCCGTATCTCCGGCACAACTTCTTCCTGCAAAATCCTGGGATGACATCGTCTTC
TTAAGGCTGATCGAGTGATAGCCGCCACTTTGACTGCATGATCGACCCGTTCTGGTAATAGTAATTCCCCTAACCGATTGAGAGTGATCAGATCTTGACG
ATCCTAATCCGAAATCACAACAGTTCCTTTCCCTTGCCTTAGAGCTTCACTCGCCAGCCAATCTGAACCCTGATTCAATTCCCGCTTCATATGCAGACAT
TCATGACTGGCCACGATCGGAGTTTCTCCATCGCT